FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631285_at:

>probe:Drosophila_2:1631285_at:607:383; Interrogation_Position=1053; Antisense; GAACATGTCATATTGCTGCCGGTGA
>probe:Drosophila_2:1631285_at:92:93; Interrogation_Position=1093; Antisense; AGTTAGCAGTGTATCCATATTGTGA
>probe:Drosophila_2:1631285_at:358:3; Interrogation_Position=1111; Antisense; ATTGTGATGTGCTCTCTAGTAGTAT
>probe:Drosophila_2:1631285_at:421:475; Interrogation_Position=1129; Antisense; GTAGTATAGTATAAGGCCCAAGGCC
>probe:Drosophila_2:1631285_at:157:69; Interrogation_Position=1149; Antisense; AGGCCCGAAACGCACCTGGAACAGG
>probe:Drosophila_2:1631285_at:338:85; Interrogation_Position=1178; Antisense; AGTGCGTTCCATACTTATCAGGCTG
>probe:Drosophila_2:1631285_at:534:685; Interrogation_Position=1193; Antisense; TATCAGGCTGGCTGCTTAGCTGCAA
>probe:Drosophila_2:1631285_at:513:707; Interrogation_Position=1208; Antisense; TTAGCTGCAAGAGTACCTGACACAT
>probe:Drosophila_2:1631285_at:459:665; Interrogation_Position=1236; Antisense; TACAGCTAGTGTGAGTCGGAATCCT
>probe:Drosophila_2:1631285_at:560:431; Interrogation_Position=1248; Antisense; GAGTCGGAATCCTTGGACCTGGATA
>probe:Drosophila_2:1631285_at:433:555; Interrogation_Position=1262; Antisense; GGACCTGGATATGCTTATGCTCGTA
>probe:Drosophila_2:1631285_at:357:703; Interrogation_Position=1276; Antisense; TTATGCTCGTAACCCTTCAACTAAA
>probe:Drosophila_2:1631285_at:693:359; Interrogation_Position=1393; Antisense; GCAACTGCCCGAAAAGCGCGAGGAA
>probe:Drosophila_2:1631285_at:673:11; Interrogation_Position=1604; Antisense; ATTTAAATTACACGCCTTCTCAAAG

Paste this into a BLAST search page for me
GAACATGTCATATTGCTGCCGGTGAAGTTAGCAGTGTATCCATATTGTGAATTGTGATGTGCTCTCTAGTAGTATGTAGTATAGTATAAGGCCCAAGGCCAGGCCCGAAACGCACCTGGAACAGGAGTGCGTTCCATACTTATCAGGCTGTATCAGGCTGGCTGCTTAGCTGCAATTAGCTGCAAGAGTACCTGACACATTACAGCTAGTGTGAGTCGGAATCCTGAGTCGGAATCCTTGGACCTGGATAGGACCTGGATATGCTTATGCTCGTATTATGCTCGTAACCCTTCAACTAAAGCAACTGCCCGAAAAGCGCGAGGAAATTTAAATTACACGCCTTCTCAAAG

Full Affymetrix probeset data:

Annotations for 1631285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720