FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631286_at:

>probe:Drosophila_2:1631286_at:325:139; Interrogation_Position=1015; Antisense; ACGGTGCCAGCAGCCTAAACGGGAA
>probe:Drosophila_2:1631286_at:257:583; Interrogation_Position=1048; Antisense; TGGCATTTACCATCAACTCACTCGA
>probe:Drosophila_2:1631286_at:612:503; Interrogation_Position=651; Antisense; GTCCATCAGACACCAACTTATCGTA
>probe:Drosophila_2:1631286_at:492:683; Interrogation_Position=669; Antisense; TATCGTAAATGCTCTTCCAGGTCAC
>probe:Drosophila_2:1631286_at:697:719; Interrogation_Position=683; Antisense; TTCCAGGTCACAGTGTTCAGGAGTT
>probe:Drosophila_2:1631286_at:165:195; Interrogation_Position=717; Antisense; AACTGCCAATTATGTGCGTGCTCAC
>probe:Drosophila_2:1631286_at:564:225; Interrogation_Position=742; Antisense; AAGGACTCGCTTATCTCATACATGA
>probe:Drosophila_2:1631286_at:15:39; Interrogation_Position=754; Antisense; ATCTCATACATGATCCACCCGGAAA
>probe:Drosophila_2:1631286_at:15:553; Interrogation_Position=781; Antisense; GGAGACATTCTGAACGACCAACAAT
>probe:Drosophila_2:1631286_at:45:195; Interrogation_Position=860; Antisense; AACTGAAGGCCATCTCATCGCTACT
>probe:Drosophila_2:1631286_at:33:631; Interrogation_Position=884; Antisense; TCCGGGTGCCCATTGAAGTTATCCA
>probe:Drosophila_2:1631286_at:219:247; Interrogation_Position=944; Antisense; AATTCGGTGGATCACCGCTGATCAT
>probe:Drosophila_2:1631286_at:79:129; Interrogation_Position=974; Antisense; ACCACCGCCACATATACCAATTGGG
>probe:Drosophila_2:1631286_at:234:247; Interrogation_Position=992; Antisense; AATTGGGTGCCCACTACAATTCCAC

Paste this into a BLAST search page for me
ACGGTGCCAGCAGCCTAAACGGGAATGGCATTTACCATCAACTCACTCGAGTCCATCAGACACCAACTTATCGTATATCGTAAATGCTCTTCCAGGTCACTTCCAGGTCACAGTGTTCAGGAGTTAACTGCCAATTATGTGCGTGCTCACAAGGACTCGCTTATCTCATACATGAATCTCATACATGATCCACCCGGAAAGGAGACATTCTGAACGACCAACAATAACTGAAGGCCATCTCATCGCTACTTCCGGGTGCCCATTGAAGTTATCCAAATTCGGTGGATCACCGCTGATCATACCACCGCCACATATACCAATTGGGAATTGGGTGCCCACTACAATTCCAC

Full Affymetrix probeset data:

Annotations for 1631286_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720