Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631288_at:

>probe:Drosophila_2:1631288_at:112:219; Interrogation_Position=1585; Antisense; AAGTACCGATGCCTGCTCTGCAATG
>probe:Drosophila_2:1631288_at:36:233; Interrogation_Position=1606; Antisense; AATGCAGAGAAGTCATCCCGTGCCG
>probe:Drosophila_2:1631288_at:123:567; Interrogation_Position=1670; Antisense; GGCACAAGTGCAGTCTCTGCGACAA
>probe:Drosophila_2:1631288_at:440:161; Interrogation_Position=1691; Antisense; ACAAGGAGTTCAAGCTGCCGCGGGC
>probe:Drosophila_2:1631288_at:649:345; Interrogation_Position=1745; Antisense; GCATCGATCTGTACCAATGCCAGTT
>probe:Drosophila_2:1631288_at:213:233; Interrogation_Position=1760; Antisense; AATGCCAGTTTTGTACGCGCACCTT
>probe:Drosophila_2:1631288_at:51:377; Interrogation_Position=1815; Antisense; GAAGAAGATGCATCCCAACGACTGG
>probe:Drosophila_2:1631288_at:178:609; Interrogation_Position=1841; Antisense; TGAGAAAGTACTCGCAGCCCAGCAG
>probe:Drosophila_2:1631288_at:715:519; Interrogation_Position=1976; Antisense; GTGGCATTGCCAAGTCGCTGATTGA
>probe:Drosophila_2:1631288_at:131:335; Interrogation_Position=1992; Antisense; GCTGATTGAGATACCCGATACCGAG
>probe:Drosophila_2:1631288_at:144:435; Interrogation_Position=2014; Antisense; GAGGGCTTCGATTTCGGCAGCAACA
>probe:Drosophila_2:1631288_at:94:135; Interrogation_Position=2053; Antisense; ACGCCCGACTGAATCTGTGTGTTGT
>probe:Drosophila_2:1631288_at:514:503; Interrogation_Position=2097; Antisense; GTCCCTGCGACTTTGTGTACACGTT
>probe:Drosophila_2:1631288_at:372:147; Interrogation_Position=2115; Antisense; ACACGTTCCCTGGTCGGGATTTATG

Paste this into a BLAST search page for me
AAGTACCGATGCCTGCTCTGCAATGAATGCAGAGAAGTCATCCCGTGCCGGGCACAAGTGCAGTCTCTGCGACAAACAAGGAGTTCAAGCTGCCGCGGGCGCATCGATCTGTACCAATGCCAGTTAATGCCAGTTTTGTACGCGCACCTTGAAGAAGATGCATCCCAACGACTGGTGAGAAAGTACTCGCAGCCCAGCAGGTGGCATTGCCAAGTCGCTGATTGAGCTGATTGAGATACCCGATACCGAGGAGGGCTTCGATTTCGGCAGCAACAACGCCCGACTGAATCTGTGTGTTGTGTCCCTGCGACTTTGTGTACACGTTACACGTTCCCTGGTCGGGATTTATG

Full Affymetrix probeset data:

Annotations for 1631288_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime