FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631289_at:

>probe:Drosophila_2:1631289_at:290:217; Interrogation_Position=203; Antisense; AAGTTCAACGCGTCAATTCGGCGGT
>probe:Drosophila_2:1631289_at:128:227; Interrogation_Position=337; Antisense; AAGGCGGCTACGGACCAGCGCAGCA
>probe:Drosophila_2:1631289_at:415:595; Interrogation_Position=376; Antisense; TGTGCGATTCGTCGGTTTACTCGTA
>probe:Drosophila_2:1631289_at:552:707; Interrogation_Position=392; Antisense; TTACTCGTACTGCTCGCACAAGATG
>probe:Drosophila_2:1631289_at:556:99; Interrogation_Position=412; Antisense; AGATGGTACACGATGCCTGTTGCTG
>probe:Drosophila_2:1631289_at:47:595; Interrogation_Position=463; Antisense; TGAGACCGCCCCAGTGTTTGTACTA
>probe:Drosophila_2:1631289_at:159:85; Interrogation_Position=475; Antisense; AGTGTTTGTACTACGACTGCTCGCT
>probe:Drosophila_2:1631289_at:152:335; Interrogation_Position=497; Antisense; GCTGCTTTATGCCAAATCCTGTTAC
>probe:Drosophila_2:1631289_at:713:305; Interrogation_Position=530; Antisense; CCTCATCAAGAACTGCTGCTGCAAT
>probe:Drosophila_2:1631289_at:183:621; Interrogation_Position=546; Antisense; TGCTGCAATAATCCCTACTGACGCG
>probe:Drosophila_2:1631289_at:565:409; Interrogation_Position=565; Antisense; GACGCGCCCATTTATCGGGAAAAAT
>probe:Drosophila_2:1631289_at:576:511; Interrogation_Position=648; Antisense; GTGATTTGTTTGCACTTCGGCTTCA
>probe:Drosophila_2:1631289_at:274:355; Interrogation_Position=659; Antisense; GCACTTCGGCTTCATTTATTTATTC
>probe:Drosophila_2:1631289_at:447:329; Interrogation_Position=728; Antisense; GCGTGCGATTGCTTGAAGCGCGCTA

Paste this into a BLAST search page for me
AAGTTCAACGCGTCAATTCGGCGGTAAGGCGGCTACGGACCAGCGCAGCATGTGCGATTCGTCGGTTTACTCGTATTACTCGTACTGCTCGCACAAGATGAGATGGTACACGATGCCTGTTGCTGTGAGACCGCCCCAGTGTTTGTACTAAGTGTTTGTACTACGACTGCTCGCTGCTGCTTTATGCCAAATCCTGTTACCCTCATCAAGAACTGCTGCTGCAATTGCTGCAATAATCCCTACTGACGCGGACGCGCCCATTTATCGGGAAAAATGTGATTTGTTTGCACTTCGGCTTCAGCACTTCGGCTTCATTTATTTATTCGCGTGCGATTGCTTGAAGCGCGCTA

Full Affymetrix probeset data:

Annotations for 1631289_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720