FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631290_at:

>probe:Drosophila_2:1631290_at:714:103; Interrogation_Position=125; Antisense; AGACGCGACTGATAGGCCAGGCCAA
>probe:Drosophila_2:1631290_at:430:51; Interrogation_Position=13; Antisense; ATGCGACGGCAAGGAGTGCATTGCT
>probe:Drosophila_2:1631290_at:300:25; Interrogation_Position=136; Antisense; ATAGGCCAGGCCAACTGCTCGCCAT
>probe:Drosophila_2:1631290_at:122:51; Interrogation_Position=159; Antisense; ATGCGCCGATCTGTACGTCTTCAAT
>probe:Drosophila_2:1631290_at:82:453; Interrogation_Position=166; Antisense; GATCTGTACGTCTTCAATCGCCAAT
>probe:Drosophila_2:1631290_at:446:315; Interrogation_Position=201; Antisense; GCGCTGCGAGCACGTCAACGGTAAT
>probe:Drosophila_2:1631290_at:651:493; Interrogation_Position=214; Antisense; GTCAACGGTAATTGCTACCCACATC
>probe:Drosophila_2:1631290_at:266:493; Interrogation_Position=221; Antisense; GTAATTGCTACCCACATCGCACGGT
>probe:Drosophila_2:1631290_at:675:61; Interrogation_Position=262; Antisense; ATGTGCGAGCTCACCTGCCAGCCGT
>probe:Drosophila_2:1631290_at:534:509; Interrogation_Position=28; Antisense; GTGCATTGCTGCTGTCTGGTGGCCA
>probe:Drosophila_2:1631290_at:607:449; Interrogation_Position=339; Antisense; GATCGTCGAGCCCTTCGGCGACAGC
>probe:Drosophila_2:1631290_at:329:581; Interrogation_Position=59; Antisense; TGGCCATGGCCATACGCCAGGTGTC
>probe:Drosophila_2:1631290_at:90:29; Interrogation_Position=70; Antisense; ATACGCCAGGTGTCCATGGGCATCA
>probe:Drosophila_2:1631290_at:120:505; Interrogation_Position=81; Antisense; GTCCATGGGCATCAGCGCCAGCGAT

Paste this into a BLAST search page for me
AGACGCGACTGATAGGCCAGGCCAAATGCGACGGCAAGGAGTGCATTGCTATAGGCCAGGCCAACTGCTCGCCATATGCGCCGATCTGTACGTCTTCAATGATCTGTACGTCTTCAATCGCCAATGCGCTGCGAGCACGTCAACGGTAATGTCAACGGTAATTGCTACCCACATCGTAATTGCTACCCACATCGCACGGTATGTGCGAGCTCACCTGCCAGCCGTGTGCATTGCTGCTGTCTGGTGGCCAGATCGTCGAGCCCTTCGGCGACAGCTGGCCATGGCCATACGCCAGGTGTCATACGCCAGGTGTCCATGGGCATCAGTCCATGGGCATCAGCGCCAGCGAT

Full Affymetrix probeset data:

Annotations for 1631290_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720