FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631293_at:

>probe:Drosophila_2:1631293_at:384:479; Interrogation_Position=166; Antisense; GTTTCCATTACCATTTGCCTGAATT
>probe:Drosophila_2:1631293_at:238:537; Interrogation_Position=192; Antisense; GGTCAGCCTATACTTAGCCAATTTG
>probe:Drosophila_2:1631293_at:33:467; Interrogation_Position=223; Antisense; GATTGGCTTGTTCTCGGGCTTATAC
>probe:Drosophila_2:1631293_at:169:571; Interrogation_Position=239; Antisense; GGCTTATACCGCTGCAGATACTCGT
>probe:Drosophila_2:1631293_at:223:457; Interrogation_Position=255; Antisense; GATACTCGTCCTTCATTGGACTTAC
>probe:Drosophila_2:1631293_at:666:167; Interrogation_Position=349; Antisense; AAATGGCTGGCATACTCCAATTTTA
>probe:Drosophila_2:1631293_at:554:105; Interrogation_Position=377; Antisense; AGACAGATTGGCCTTCGATTGAAAA
>probe:Drosophila_2:1631293_at:180:167; Interrogation_Position=399; Antisense; AAATGCGGTTTTATGCTGTGGACTG
>probe:Drosophila_2:1631293_at:292:531; Interrogation_Position=426; Antisense; GGGTCCCCGTTCTTATATGGATTAT
>probe:Drosophila_2:1631293_at:685:259; Interrogation_Position=492; Antisense; CACCCAAGGTTGCAGTGACTTTGTT
>probe:Drosophila_2:1631293_at:103:497; Interrogation_Position=548; Antisense; GTCATTTGCAGCTCAGATTGGCTAT
>probe:Drosophila_2:1631293_at:522:15; Interrogation_Position=589; Antisense; ATTTTACTTATTCTTGCTGCAACGC
>probe:Drosophila_2:1631293_at:146:99; Interrogation_Position=658; Antisense; AGAGTTATTACACACGGGCTTGCGG
>probe:Drosophila_2:1631293_at:48:261; Interrogation_Position=670; Antisense; CACGGGCTTGCGGTACTAATAGATT

Paste this into a BLAST search page for me
GTTTCCATTACCATTTGCCTGAATTGGTCAGCCTATACTTAGCCAATTTGGATTGGCTTGTTCTCGGGCTTATACGGCTTATACCGCTGCAGATACTCGTGATACTCGTCCTTCATTGGACTTACAAATGGCTGGCATACTCCAATTTTAAGACAGATTGGCCTTCGATTGAAAAAAATGCGGTTTTATGCTGTGGACTGGGGTCCCCGTTCTTATATGGATTATCACCCAAGGTTGCAGTGACTTTGTTGTCATTTGCAGCTCAGATTGGCTATATTTTACTTATTCTTGCTGCAACGCAGAGTTATTACACACGGGCTTGCGGCACGGGCTTGCGGTACTAATAGATT

Full Affymetrix probeset data:

Annotations for 1631293_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720