FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631294_at:

>probe:Drosophila_2:1631294_at:363:619; Interrogation_Position=102; Antisense; TGCTCCATTGGATACCTTTGTCATG
>probe:Drosophila_2:1631294_at:102:497; Interrogation_Position=121; Antisense; GTCATGGCCATCGAAGATTGCGCTT
>probe:Drosophila_2:1631294_at:156:465; Interrogation_Position=136; Antisense; GATTGCGCTTCATACATCTATTGCA
>probe:Drosophila_2:1631294_at:219:423; Interrogation_Position=164; Antisense; GAGAAGACTCCTTCCGAGACAGCTG
>probe:Drosophila_2:1631294_at:72:433; Interrogation_Position=193; Antisense; GAGTCCACCTACTTTGACGATCGAA
>probe:Drosophila_2:1631294_at:299:451; Interrogation_Position=211; Antisense; GATCGAACCCAAGAGTGTGCCTTTG
>probe:Drosophila_2:1631294_at:538:87; Interrogation_Position=270; Antisense; AGTCCAGACTGAGGAGCAGCCCGAT
>probe:Drosophila_2:1631294_at:122:15; Interrogation_Position=362; Antisense; ATTACGCCTCTACAGGATCTGCGGA
>probe:Drosophila_2:1631294_at:423:405; Interrogation_Position=385; Antisense; GACTCTTCTACTTTCCAAGCTGATT
>probe:Drosophila_2:1631294_at:4:365; Interrogation_Position=427; Antisense; GAATCAATTCCTTCAGTGACTGAGC
>probe:Drosophila_2:1631294_at:462:355; Interrogation_Position=519; Antisense; GCACTGCGACATTTCCGGAGATGGT
>probe:Drosophila_2:1631294_at:274:429; Interrogation_Position=568; Antisense; GAGTACTACTACAGGTGCCTCAGCG
>probe:Drosophila_2:1631294_at:374:217; Interrogation_Position=622; Antisense; AAGTATGGCTGGGACTTTCCTACAA
>probe:Drosophila_2:1631294_at:575:325; Interrogation_Position=665; Antisense; GCGAGGCTCAGTGCTTTAGTTATAG

Paste this into a BLAST search page for me
TGCTCCATTGGATACCTTTGTCATGGTCATGGCCATCGAAGATTGCGCTTGATTGCGCTTCATACATCTATTGCAGAGAAGACTCCTTCCGAGACAGCTGGAGTCCACCTACTTTGACGATCGAAGATCGAACCCAAGAGTGTGCCTTTGAGTCCAGACTGAGGAGCAGCCCGATATTACGCCTCTACAGGATCTGCGGAGACTCTTCTACTTTCCAAGCTGATTGAATCAATTCCTTCAGTGACTGAGCGCACTGCGACATTTCCGGAGATGGTGAGTACTACTACAGGTGCCTCAGCGAAGTATGGCTGGGACTTTCCTACAAGCGAGGCTCAGTGCTTTAGTTATAG

Full Affymetrix probeset data:

Annotations for 1631294_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720