FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631296_at:

>probe:Drosophila_2:1631296_at:209:299; Interrogation_Position=156; Antisense; CCCAACTCGTACTTCATGGACGTGA
>probe:Drosophila_2:1631296_at:17:65; Interrogation_Position=171; Antisense; ATGGACGTGAAGTGCCCCGGCTGCT
>probe:Drosophila_2:1631296_at:603:297; Interrogation_Position=242; Antisense; CGCTGGATGCGCTACCATTTTGTGC
>probe:Drosophila_2:1631296_at:218:273; Interrogation_Position=257; Antisense; CATTTTGTGCCAGCCGACTGGAGGA
>probe:Drosophila_2:1631296_at:662:109; Interrogation_Position=296; Antisense; AGAAGGCTGCTCCTTCCGCAGGAAG
>probe:Drosophila_2:1631296_at:340:527; Interrogation_Position=333; Antisense; GGGACTCGCGATGAACCACAAATTA
>probe:Drosophila_2:1631296_at:195:203; Interrogation_Position=392; Antisense; AACCACAGAACCCATACGAGAGAAA
>probe:Drosophila_2:1631296_at:169:729; Interrogation_Position=419; Antisense; TTGTAATTCAATTGCTGCGGTCCTT
>probe:Drosophila_2:1631296_at:516:285; Interrogation_Position=436; Antisense; CGGTCCTTTGGTTCATTGTGCTTTG
>probe:Drosophila_2:1631296_at:704:389; Interrogation_Position=473; Antisense; TTAACGATGTTGTGGTCGGCTAAGT
>probe:Drosophila_2:1631296_at:96:631; Interrogation_Position=584; Antisense; TCCCCGATAAGAAACCGCCCATAAT
>probe:Drosophila_2:1631296_at:692:299; Interrogation_Position=599; Antisense; CGCCCATAATGGAAGCTCTTGTGTG
>probe:Drosophila_2:1631296_at:445:517; Interrogation_Position=619; Antisense; GTGTGTGCAAATACCCTTGTGCGGC
>probe:Drosophila_2:1631296_at:363:275; Interrogation_Position=634; Antisense; CTTGTGCGGCAAAACTTCAGGAATT

Paste this into a BLAST search page for me
CCCAACTCGTACTTCATGGACGTGAATGGACGTGAAGTGCCCCGGCTGCTCGCTGGATGCGCTACCATTTTGTGCCATTTTGTGCCAGCCGACTGGAGGAAGAAGGCTGCTCCTTCCGCAGGAAGGGGACTCGCGATGAACCACAAATTAAACCACAGAACCCATACGAGAGAAATTGTAATTCAATTGCTGCGGTCCTTCGGTCCTTTGGTTCATTGTGCTTTGTTAACGATGTTGTGGTCGGCTAAGTTCCCCGATAAGAAACCGCCCATAATCGCCCATAATGGAAGCTCTTGTGTGGTGTGTGCAAATACCCTTGTGCGGCCTTGTGCGGCAAAACTTCAGGAATT

Full Affymetrix probeset data:

Annotations for 1631296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720