FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631297_at:

>probe:Drosophila_2:1631297_at:359:715; Interrogation_Position=2032; Antisense; TTCTCAAGGCGAGCAAGCGTCGCAT
>probe:Drosophila_2:1631297_at:490:329; Interrogation_Position=2048; Antisense; GCGTCGCATGTCTAGTTGTGGGCAA
>probe:Drosophila_2:1631297_at:8:519; Interrogation_Position=2065; Antisense; GTGGGCAAAGATCCCTGCTAGATAT
>probe:Drosophila_2:1631297_at:521:121; Interrogation_Position=2104; Antisense; AGCGAAGCCAGTCCAACAAACGATT
>probe:Drosophila_2:1631297_at:169:193; Interrogation_Position=2122; Antisense; AACGATTGGATTTCTCGGGACGCCT
>probe:Drosophila_2:1631297_at:328:131; Interrogation_Position=2141; Antisense; ACGCCTTTGCACTCCGTTGGGTCAA
>probe:Drosophila_2:1631297_at:652:221; Interrogation_Position=2164; Antisense; AAGTGGCCAAGCTGTATCCGGATTT
>probe:Drosophila_2:1631297_at:162:115; Interrogation_Position=2173; Antisense; AGCTGTATCCGGATTTTGGTACCAA
>probe:Drosophila_2:1631297_at:623:167; Interrogation_Position=2267; Antisense; AAATGGCACGGAGAACGCCGAATTT
>probe:Drosophila_2:1631297_at:645:185; Interrogation_Position=2344; Antisense; AACAATGCTTAGTGTACGGCTTAAT
>probe:Drosophila_2:1631297_at:226:429; Interrogation_Position=2405; Antisense; GAGTTTCGTATAATCGCTTCTTTAA
>probe:Drosophila_2:1631297_at:656:341; Interrogation_Position=2420; Antisense; GCTTCTTTAAGACTGGGACAACATT
>probe:Drosophila_2:1631297_at:194:9; Interrogation_Position=2466; Antisense; ATTCCTCTATTTAAGCTGCCTCAAA
>probe:Drosophila_2:1631297_at:494:513; Interrogation_Position=2568; Antisense; GTGATTGTGATCTTTGGCACGGTAA

Paste this into a BLAST search page for me
TTCTCAAGGCGAGCAAGCGTCGCATGCGTCGCATGTCTAGTTGTGGGCAAGTGGGCAAAGATCCCTGCTAGATATAGCGAAGCCAGTCCAACAAACGATTAACGATTGGATTTCTCGGGACGCCTACGCCTTTGCACTCCGTTGGGTCAAAAGTGGCCAAGCTGTATCCGGATTTAGCTGTATCCGGATTTTGGTACCAAAAATGGCACGGAGAACGCCGAATTTAACAATGCTTAGTGTACGGCTTAATGAGTTTCGTATAATCGCTTCTTTAAGCTTCTTTAAGACTGGGACAACATTATTCCTCTATTTAAGCTGCCTCAAAGTGATTGTGATCTTTGGCACGGTAA

Full Affymetrix probeset data:

Annotations for 1631297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720