FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631298_at:

>probe:Drosophila_2:1631298_at:299:295; Interrogation_Position=1008; Antisense; CGACTCCCTTTTTCAATCGGACTGG
>probe:Drosophila_2:1631298_at:514:645; Interrogation_Position=1083; Antisense; TCTTCAGCAGCCCATTATTCTTACG
>probe:Drosophila_2:1631298_at:359:685; Interrogation_Position=1098; Antisense; TATTCTTACGGCTGGTGGAGTCTTT
>probe:Drosophila_2:1631298_at:228:373; Interrogation_Position=1155; Antisense; GAAGCTGGCCTTTACTGTGGTTACA
>probe:Drosophila_2:1631298_at:467:359; Interrogation_Position=1229; Antisense; GCAAGCTCTGCTATTATAAACCTAC
>probe:Drosophila_2:1631298_at:274:713; Interrogation_Position=1287; Antisense; TTCAGTACTTACTGCTTGTGGCGCC
>probe:Drosophila_2:1631298_at:249:431; Interrogation_Position=739; Antisense; GAGTACTTGAAGGAGCTCGCCGACT
>probe:Drosophila_2:1631298_at:428:405; Interrogation_Position=760; Antisense; GACTGCGTTCGAGATCACCGCTTGA
>probe:Drosophila_2:1631298_at:352:651; Interrogation_Position=774; Antisense; TCACCGCTTGATATTGGACTATGTC
>probe:Drosophila_2:1631298_at:606:477; Interrogation_Position=888; Antisense; GTTTTTCTCAACACTTTCGACTGGT
>probe:Drosophila_2:1631298_at:711:515; Interrogation_Position=911; Antisense; GTGTCGCCGTTGTCCTTTTTATGTC
>probe:Drosophila_2:1631298_at:302:307; Interrogation_Position=924; Antisense; CCTTTTTATGTCCTGCGTATCTATG
>probe:Drosophila_2:1631298_at:468:483; Interrogation_Position=940; Antisense; GTATCTATGCAGACGTTCCCCTTTT
>probe:Drosophila_2:1631298_at:439:29; Interrogation_Position=989; Antisense; ATGACTGCCAAGAGATGGCCGACTC

Paste this into a BLAST search page for me
CGACTCCCTTTTTCAATCGGACTGGTCTTCAGCAGCCCATTATTCTTACGTATTCTTACGGCTGGTGGAGTCTTTGAAGCTGGCCTTTACTGTGGTTACAGCAAGCTCTGCTATTATAAACCTACTTCAGTACTTACTGCTTGTGGCGCCGAGTACTTGAAGGAGCTCGCCGACTGACTGCGTTCGAGATCACCGCTTGATCACCGCTTGATATTGGACTATGTCGTTTTTCTCAACACTTTCGACTGGTGTGTCGCCGTTGTCCTTTTTATGTCCCTTTTTATGTCCTGCGTATCTATGGTATCTATGCAGACGTTCCCCTTTTATGACTGCCAAGAGATGGCCGACTC

Full Affymetrix probeset data:

Annotations for 1631298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720