Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631300_at:

>probe:Drosophila_2:1631300_at:372:229; Interrogation_Position=2262; Antisense; AATGGGAGGCCATTTCCATTCTGGC
>probe:Drosophila_2:1631300_at:311:633; Interrogation_Position=2288; Antisense; TCCCATCGCGAGCTATCGATTTAGC
>probe:Drosophila_2:1631300_at:231:659; Interrogation_Position=2315; Antisense; TAAGTTAGTAGTTATCCGCCCGTGG
>probe:Drosophila_2:1631300_at:45:553; Interrogation_Position=2342; Antisense; GGAGCACATCCGGATACCGGCTAGA
>probe:Drosophila_2:1631300_at:475:125; Interrogation_Position=2391; Antisense; AGCCGGAAGCTGTGACCAACGCACA
>probe:Drosophila_2:1631300_at:625:437; Interrogation_Position=2416; Antisense; GAGGACTGCAACCAATTCTATTCTT
>probe:Drosophila_2:1631300_at:503:301; Interrogation_Position=2445; Antisense; CCCCAAGAAGCTGTGTTCAACTAAT
>probe:Drosophila_2:1631300_at:179:319; Interrogation_Position=2493; Antisense; GCCCTAGTTAGGTTCGATTATACAG
>probe:Drosophila_2:1631300_at:322:707; Interrogation_Position=2555; Antisense; TTACTACCGCTAATGCTAAGATACC
>probe:Drosophila_2:1631300_at:207:215; Interrogation_Position=2572; Antisense; AAGATACCGCTATGTCTACAGCCAG
>probe:Drosophila_2:1631300_at:391:311; Interrogation_Position=2592; Antisense; GCCAGCAGGCCGATTAAGTTTAGTT
>probe:Drosophila_2:1631300_at:598:337; Interrogation_Position=2618; Antisense; GCTAACGTTCTTGTTTATCCGTAGT
>probe:Drosophila_2:1631300_at:51:705; Interrogation_Position=2644; Antisense; TTAGTGCTAGCTTAATGTCCAAACA
>probe:Drosophila_2:1631300_at:140:539; Interrogation_Position=2690; Antisense; GGTTTAGTCTTACAAGCACACATCA

Paste this into a BLAST search page for me
AATGGGAGGCCATTTCCATTCTGGCTCCCATCGCGAGCTATCGATTTAGCTAAGTTAGTAGTTATCCGCCCGTGGGGAGCACATCCGGATACCGGCTAGAAGCCGGAAGCTGTGACCAACGCACAGAGGACTGCAACCAATTCTATTCTTCCCCAAGAAGCTGTGTTCAACTAATGCCCTAGTTAGGTTCGATTATACAGTTACTACCGCTAATGCTAAGATACCAAGATACCGCTATGTCTACAGCCAGGCCAGCAGGCCGATTAAGTTTAGTTGCTAACGTTCTTGTTTATCCGTAGTTTAGTGCTAGCTTAATGTCCAAACAGGTTTAGTCTTACAAGCACACATCA

Full Affymetrix probeset data:

Annotations for 1631300_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime