FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631301_at:

>probe:Drosophila_2:1631301_at:573:483; Interrogation_Position=370; Antisense; GTATGCTGGATCACATCACCATCGA
>probe:Drosophila_2:1631301_at:421:137; Interrogation_Position=486; Antisense; ACGGAGCCACCACACTTTAGGAATT
>probe:Drosophila_2:1631301_at:634:341; Interrogation_Position=512; Antisense; GCTTAACTTTTTCGAGGTGCTGGTC
>probe:Drosophila_2:1631301_at:324:535; Interrogation_Position=527; Antisense; GGTGCTGGTCAAGAACTGTCGCTAT
>probe:Drosophila_2:1631301_at:583:279; Interrogation_Position=552; Antisense; CTAAAGTATATTCGCCTCACTACGC
>probe:Drosophila_2:1631301_at:307:407; Interrogation_Position=587; Antisense; GACGGCGCCCAAGAATCAGTTGCAG
>probe:Drosophila_2:1631301_at:310:581; Interrogation_Position=637; Antisense; TGGCCGGTGGCAACATCCAGATGAA
>probe:Drosophila_2:1631301_at:219:67; Interrogation_Position=669; Antisense; ATGGACGACAGTTTGCACGATCGCA
>probe:Drosophila_2:1631301_at:683:93; Interrogation_Position=694; Antisense; AGATCGTTCTTAGCTCGGGAGTGGT
>probe:Drosophila_2:1631301_at:554:589; Interrogation_Position=715; Antisense; TGGTCATTAAGATTGGCCGTGGCCT
>probe:Drosophila_2:1631301_at:219:711; Interrogation_Position=739; Antisense; TTCACTACTTCGAGCCCATGGAGGG
>probe:Drosophila_2:1631301_at:104:481; Interrogation_Position=772; Antisense; GTTTGGGTCTGTGCGATTTCGATTT
>probe:Drosophila_2:1631301_at:170:717; Interrogation_Position=789; Antisense; TTCGATTTTCGCAAGTGCCTGGCCA
>probe:Drosophila_2:1631301_at:225:373; Interrogation_Position=830; Antisense; GAAGTGTCGTCCTTTTGCGAGGCGC

Paste this into a BLAST search page for me
GTATGCTGGATCACATCACCATCGAACGGAGCCACCACACTTTAGGAATTGCTTAACTTTTTCGAGGTGCTGGTCGGTGCTGGTCAAGAACTGTCGCTATCTAAAGTATATTCGCCTCACTACGCGACGGCGCCCAAGAATCAGTTGCAGTGGCCGGTGGCAACATCCAGATGAAATGGACGACAGTTTGCACGATCGCAAGATCGTTCTTAGCTCGGGAGTGGTTGGTCATTAAGATTGGCCGTGGCCTTTCACTACTTCGAGCCCATGGAGGGGTTTGGGTCTGTGCGATTTCGATTTTTCGATTTTCGCAAGTGCCTGGCCAGAAGTGTCGTCCTTTTGCGAGGCGC

Full Affymetrix probeset data:

Annotations for 1631301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720