FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631302_at:

>probe:Drosophila_2:1631302_at:327:651; Interrogation_Position=1122; Antisense; TCACACAACTGACGCAATCCATTAT
>probe:Drosophila_2:1631302_at:716:673; Interrogation_Position=1146; Antisense; TAGAAAGCTTGCCAAAACCCATCCG
>probe:Drosophila_2:1631302_at:368:327; Interrogation_Position=1173; Antisense; GCGTTTGAAAAGTGCCTGTCTCCTG
>probe:Drosophila_2:1631302_at:137:631; Interrogation_Position=1193; Antisense; TCCTGGCATCCAAATCCATCGAGTG
>probe:Drosophila_2:1631302_at:682:45; Interrogation_Position=1206; Antisense; ATCCATCGAGTGTACAGTTCTTTTG
>probe:Drosophila_2:1631302_at:269:31; Interrogation_Position=1248; Antisense; ATAACTGCTGACGAGTTGCTCCTTC
>probe:Drosophila_2:1631302_at:245:327; Interrogation_Position=1265; Antisense; GCTCCTTCGACTTTTTCACGTAAAT
>probe:Drosophila_2:1631302_at:192:105; Interrogation_Position=788; Antisense; AGCCACGGCTACTCCGGACACGGAA
>probe:Drosophila_2:1631302_at:421:399; Interrogation_Position=804; Antisense; GACACGGAATCTCCGGATACGGAAT
>probe:Drosophila_2:1631302_at:627:361; Interrogation_Position=825; Antisense; GAATTTCCGGACACGGAATCTCCTC
>probe:Drosophila_2:1631302_at:420:143; Interrogation_Position=881; Antisense; CACGGTGGCTACCTCCACAAAAAGT
>probe:Drosophila_2:1631302_at:62:89; Interrogation_Position=903; Antisense; AGTAGATGAAATCGCAATGCTGTCG
>probe:Drosophila_2:1631302_at:209:251; Interrogation_Position=917; Antisense; CAATGCTGTCGAGGGCCAAGCGAGA
>probe:Drosophila_2:1631302_at:233:401; Interrogation_Position=996; Antisense; GACATTAAGAATCAAGCACCCCTCC

Paste this into a BLAST search page for me
TCACACAACTGACGCAATCCATTATTAGAAAGCTTGCCAAAACCCATCCGGCGTTTGAAAAGTGCCTGTCTCCTGTCCTGGCATCCAAATCCATCGAGTGATCCATCGAGTGTACAGTTCTTTTGATAACTGCTGACGAGTTGCTCCTTCGCTCCTTCGACTTTTTCACGTAAATAGCCACGGCTACTCCGGACACGGAAGACACGGAATCTCCGGATACGGAATGAATTTCCGGACACGGAATCTCCTCCACGGTGGCTACCTCCACAAAAAGTAGTAGATGAAATCGCAATGCTGTCGCAATGCTGTCGAGGGCCAAGCGAGAGACATTAAGAATCAAGCACCCCTCC

Full Affymetrix probeset data:

Annotations for 1631302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720