Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631306_at:

>probe:Drosophila_2:1631306_at:2:443; Interrogation_Position=1121; Antisense; GATGTGTTCCTTCGCAGATCTAGAG
>probe:Drosophila_2:1631306_at:526:255; Interrogation_Position=1157; Antisense; CAAACTGGCCATACGACGGTACGAT
>probe:Drosophila_2:1631306_at:342:427; Interrogation_Position=1185; Antisense; GAGATGCTGCGACCGTTTAACGTGA
>probe:Drosophila_2:1631306_at:401:519; Interrogation_Position=1224; Antisense; GTGGTCTTCGATGAGTCCAGCCAAC
>probe:Drosophila_2:1631306_at:224:565; Interrogation_Position=1250; Antisense; GGAATACTTGCGAGACTCCTTCGAT
>probe:Drosophila_2:1631306_at:646:701; Interrogation_Position=1280; Antisense; TTATATGTACCCGATGAGCGCCTTG
>probe:Drosophila_2:1631306_at:181:417; Interrogation_Position=1295; Antisense; GAGCGCCTTGAGTTGGAGTGCCTTC
>probe:Drosophila_2:1631306_at:497:717; Interrogation_Position=1338; Antisense; TTCGCATTCCCACTGTTTTACTATT
>probe:Drosophila_2:1631306_at:446:91; Interrogation_Position=1398; Antisense; AGTTTCCCCATAAGACGACACTTGC
>probe:Drosophila_2:1631306_at:335:321; Interrogation_Position=1421; Antisense; GCCCTATCGCGATCTCTTTGAGGAA
>probe:Drosophila_2:1631306_at:168:381; Interrogation_Position=1535; Antisense; GAACGATTTTAGTCCACCACGGTTG
>probe:Drosophila_2:1631306_at:391:217; Interrogation_Position=1573; Antisense; AAGTAAGCGATCTCTCCTGGGTTTT
>probe:Drosophila_2:1631306_at:478:563; Interrogation_Position=1599; Antisense; GGAATGTACTTCACCGGACTGGGCA
>probe:Drosophila_2:1631306_at:360:555; Interrogation_Position=1669; Antisense; GGACGCGACGCTTGAGGCTAACCAA

Paste this into a BLAST search page for me
GATGTGTTCCTTCGCAGATCTAGAGCAAACTGGCCATACGACGGTACGATGAGATGCTGCGACCGTTTAACGTGAGTGGTCTTCGATGAGTCCAGCCAACGGAATACTTGCGAGACTCCTTCGATTTATATGTACCCGATGAGCGCCTTGGAGCGCCTTGAGTTGGAGTGCCTTCTTCGCATTCCCACTGTTTTACTATTAGTTTCCCCATAAGACGACACTTGCGCCCTATCGCGATCTCTTTGAGGAAGAACGATTTTAGTCCACCACGGTTGAAGTAAGCGATCTCTCCTGGGTTTTGGAATGTACTTCACCGGACTGGGCAGGACGCGACGCTTGAGGCTAACCAA

Full Affymetrix probeset data:

Annotations for 1631306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime