FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631308_at:

>probe:Drosophila_2:1631308_at:199:147; Interrogation_Position=3027; Antisense; ACTAAACTCAATTCAGCGGCGGCAG
>probe:Drosophila_2:1631308_at:32:99; Interrogation_Position=3050; Antisense; AGATCGCAGCATACGGAAGCTGTGA
>probe:Drosophila_2:1631308_at:529:525; Interrogation_Position=3080; Antisense; GGGAATACCCTGGAATCCAAGCCAG
>probe:Drosophila_2:1631308_at:615:563; Interrogation_Position=3091; Antisense; GGAATCCAAGCCAGACAGCCCCAAG
>probe:Drosophila_2:1631308_at:481:223; Interrogation_Position=3164; Antisense; AAGGAGCTGTGCTAACCATCTTCTT
>probe:Drosophila_2:1631308_at:720:339; Interrogation_Position=3174; Antisense; GCTAACCATCTTCTTCTGCTATGGA
>probe:Drosophila_2:1631308_at:544:713; Interrogation_Position=3184; Antisense; TTCTTCTGCTATGGAACATCTCGAT
>probe:Drosophila_2:1631308_at:330:149; Interrogation_Position=3199; Antisense; ACATCTCGATACATTTTACGTTATT
>probe:Drosophila_2:1631308_at:63:17; Interrogation_Position=3221; Antisense; ATTTATTTATACACTCACGCGAACA
>probe:Drosophila_2:1631308_at:77:651; Interrogation_Position=3235; Antisense; TCACGCGAACACACACATGTGCAAT
>probe:Drosophila_2:1631308_at:136:499; Interrogation_Position=3253; Antisense; GTGCAATAAGTTCTTTGGATTCGTT
>probe:Drosophila_2:1631308_at:310:695; Interrogation_Position=3278; Antisense; TTTAACCCATTTCTCCGTGTCAACG
>probe:Drosophila_2:1631308_at:203:19; Interrogation_Position=3286; Antisense; ATTTCTCCGTGTCAACGTGCTCGAG
>probe:Drosophila_2:1631308_at:726:337; Interrogation_Position=3304; Antisense; GCTCGAGCCCTTTGATATTTTGTAT

Paste this into a BLAST search page for me
ACTAAACTCAATTCAGCGGCGGCAGAGATCGCAGCATACGGAAGCTGTGAGGGAATACCCTGGAATCCAAGCCAGGGAATCCAAGCCAGACAGCCCCAAGAAGGAGCTGTGCTAACCATCTTCTTGCTAACCATCTTCTTCTGCTATGGATTCTTCTGCTATGGAACATCTCGATACATCTCGATACATTTTACGTTATTATTTATTTATACACTCACGCGAACATCACGCGAACACACACATGTGCAATGTGCAATAAGTTCTTTGGATTCGTTTTTAACCCATTTCTCCGTGTCAACGATTTCTCCGTGTCAACGTGCTCGAGGCTCGAGCCCTTTGATATTTTGTAT

Full Affymetrix probeset data:

Annotations for 1631308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720