FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631309_at:

>probe:Drosophila_2:1631309_at:219:689; Interrogation_Position=1548; Antisense; TTTAGCCCTAGCACCGATTGGGACA
>probe:Drosophila_2:1631309_at:632:465; Interrogation_Position=1563; Antisense; GATTGGGACACGGTAGACTTCAGCA
>probe:Drosophila_2:1631309_at:72:677; Interrogation_Position=1576; Antisense; TAGACTTCAGCAAATCGGATGCCAT
>probe:Drosophila_2:1631309_at:729:531; Interrogation_Position=1613; Antisense; GGTGACATCGGCCATCTGTACGCCA
>probe:Drosophila_2:1631309_at:722:135; Interrogation_Position=1666; Antisense; ACGACGAGGGTCACATCACGGTTAG
>probe:Drosophila_2:1631309_at:485:473; Interrogation_Position=1725; Antisense; GTAAGGGTGGACCTAACCAACGATG
>probe:Drosophila_2:1631309_at:112:515; Interrogation_Position=1753; Antisense; GTGTTAGCTGGCACGTGGCCGAACT
>probe:Drosophila_2:1631309_at:36:427; Interrogation_Position=1788; Antisense; GAGATGCCCGATGGCAGACACTACG
>probe:Drosophila_2:1631309_at:583:105; Interrogation_Position=1803; Antisense; AGACACTACGGCTGGTCCCTGTGGA
>probe:Drosophila_2:1631309_at:662:623; Interrogation_Position=1837; Antisense; TGCCCGTTTCCGAGGCCCAAAGGAG
>probe:Drosophila_2:1631309_at:97:469; Interrogation_Position=1893; Antisense; GTTGACTCGGCGTACAATGTGCAGC
>probe:Drosophila_2:1631309_at:689:229; Interrogation_Position=1908; Antisense; AATGTGCAGCCGGAGAAATTCGAGC
>probe:Drosophila_2:1631309_at:543:271; Interrogation_Position=1934; Antisense; CATCTGGAATCTGCGTGGCGTCTTG
>probe:Drosophila_2:1631309_at:63:581; Interrogation_Position=1957; Antisense; TGGCCAACGCGTATCACAAAGTCAA

Paste this into a BLAST search page for me
TTTAGCCCTAGCACCGATTGGGACAGATTGGGACACGGTAGACTTCAGCATAGACTTCAGCAAATCGGATGCCATGGTGACATCGGCCATCTGTACGCCAACGACGAGGGTCACATCACGGTTAGGTAAGGGTGGACCTAACCAACGATGGTGTTAGCTGGCACGTGGCCGAACTGAGATGCCCGATGGCAGACACTACGAGACACTACGGCTGGTCCCTGTGGATGCCCGTTTCCGAGGCCCAAAGGAGGTTGACTCGGCGTACAATGTGCAGCAATGTGCAGCCGGAGAAATTCGAGCCATCTGGAATCTGCGTGGCGTCTTGTGGCCAACGCGTATCACAAAGTCAA

Full Affymetrix probeset data:

Annotations for 1631309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720