Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631311_at:

>probe:Drosophila_2:1631311_at:106:651; Interrogation_Position=3856; Antisense; TCAGCCAGTGGCATCGTTGTCGAGA
>probe:Drosophila_2:1631311_at:588:395; Interrogation_Position=3907; Antisense; GAAATCATCTATCATCATCCCACAA
>probe:Drosophila_2:1631311_at:243:89; Interrogation_Position=3955; Antisense; AGTAGCTGCAGTGCGGCTGCAACAC
>probe:Drosophila_2:1631311_at:102:293; Interrogation_Position=4006; Antisense; CGTTTACAGCTACCCGCAGTGGCAA
>probe:Drosophila_2:1631311_at:585:565; Interrogation_Position=4026; Antisense; GGCAACGGCCACGACTAACAATATT
>probe:Drosophila_2:1631311_at:600:31; Interrogation_Position=4067; Antisense; ATAAGCATGGTGCAACCGGCCACAA
>probe:Drosophila_2:1631311_at:349:257; Interrogation_Position=4087; Antisense; CACAACGGCAGCATCGGCAATTATA
>probe:Drosophila_2:1631311_at:498:227; Interrogation_Position=4111; Antisense; AAGGCGCATACGTTTAGTGATAGCT
>probe:Drosophila_2:1631311_at:193:423; Interrogation_Position=4186; Antisense; GAGACAGCCGCAGTGACAGCAGCAG
>probe:Drosophila_2:1631311_at:566:453; Interrogation_Position=4225; Antisense; GATCAGGCGGGCTCATCCTTGTCCA
>probe:Drosophila_2:1631311_at:331:263; Interrogation_Position=4248; Antisense; CAGCACCTCAGTGTCGAGCATAGAA
>probe:Drosophila_2:1631311_at:245:373; Interrogation_Position=4309; Antisense; GAAGTGTACTTGTCTCTGAACTTGA
>probe:Drosophila_2:1631311_at:180:149; Interrogation_Position=4328; Antisense; ACTTGACATTGGCTGATGCTGCTGC
>probe:Drosophila_2:1631311_at:683:103; Interrogation_Position=4380; Antisense; AGACGCATCTGCAGACAGGGCCGAG

Paste this into a BLAST search page for me
TCAGCCAGTGGCATCGTTGTCGAGAGAAATCATCTATCATCATCCCACAAAGTAGCTGCAGTGCGGCTGCAACACCGTTTACAGCTACCCGCAGTGGCAAGGCAACGGCCACGACTAACAATATTATAAGCATGGTGCAACCGGCCACAACACAACGGCAGCATCGGCAATTATAAAGGCGCATACGTTTAGTGATAGCTGAGACAGCCGCAGTGACAGCAGCAGGATCAGGCGGGCTCATCCTTGTCCACAGCACCTCAGTGTCGAGCATAGAAGAAGTGTACTTGTCTCTGAACTTGAACTTGACATTGGCTGATGCTGCTGCAGACGCATCTGCAGACAGGGCCGAG

Full Affymetrix probeset data:

Annotations for 1631311_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime