FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631312_at:

>probe:Drosophila_2:1631312_at:175:335; Interrogation_Position=517; Antisense; GCTGATCATGGCCTACGTGTACCTG
>probe:Drosophila_2:1631312_at:359:85; Interrogation_Position=549; Antisense; AGTGTCCGTGCAATGGTCTGCTGGC
>probe:Drosophila_2:1631312_at:171:621; Interrogation_Position=567; Antisense; TGCTGGCCATTGTCATCGTGGAGGT
>probe:Drosophila_2:1631312_at:42:639; Interrogation_Position=625; Antisense; TCGTCTATCGATGCTCTGGATGACT
>probe:Drosophila_2:1631312_at:601:381; Interrogation_Position=676; Antisense; GAACGTCATGCTCTACTTGATGGGC
>probe:Drosophila_2:1631312_at:39:685; Interrogation_Position=704; Antisense; TATCTGCCGCTGAAAATACTGCCCG
>probe:Drosophila_2:1631312_at:504:539; Interrogation_Position=728; Antisense; GGTAGCATCTTCATGATCGTCCTCA
>probe:Drosophila_2:1631312_at:210:505; Interrogation_Position=746; Antisense; GTCCTCACATTCTGTTGCATAGCGA
>probe:Drosophila_2:1631312_at:26:329; Interrogation_Position=767; Antisense; GCGATTGTCGTTTCGATCTACTTGA
>probe:Drosophila_2:1631312_at:11:457; Interrogation_Position=825; Antisense; GATACGTCTCGATGGTCAGTCTGAT
>probe:Drosophila_2:1631312_at:663:87; Interrogation_Position=842; Antisense; AGTCTGATCTACGTGGCTAGTCTCA
>probe:Drosophila_2:1631312_at:647:33; Interrogation_Position=878; Antisense; ATCACCGTTATCCACCAGCGAAGAT
>probe:Drosophila_2:1631312_at:30:547; Interrogation_Position=913; Antisense; GGATCGCACCGAATATGTCCTGCAG
>probe:Drosophila_2:1631312_at:393:285; Interrogation_Position=956; Antisense; CTGTTCGTCTATATGATTCACCCAC

Paste this into a BLAST search page for me
GCTGATCATGGCCTACGTGTACCTGAGTGTCCGTGCAATGGTCTGCTGGCTGCTGGCCATTGTCATCGTGGAGGTTCGTCTATCGATGCTCTGGATGACTGAACGTCATGCTCTACTTGATGGGCTATCTGCCGCTGAAAATACTGCCCGGGTAGCATCTTCATGATCGTCCTCAGTCCTCACATTCTGTTGCATAGCGAGCGATTGTCGTTTCGATCTACTTGAGATACGTCTCGATGGTCAGTCTGATAGTCTGATCTACGTGGCTAGTCTCAATCACCGTTATCCACCAGCGAAGATGGATCGCACCGAATATGTCCTGCAGCTGTTCGTCTATATGATTCACCCAC

Full Affymetrix probeset data:

Annotations for 1631312_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720