FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631313_at:

>probe:Drosophila_2:1631313_at:509:59; Interrogation_Position=1002; Antisense; ATGTTCCTACTGTGAATTTTTTCTA
>probe:Drosophila_2:1631313_at:586:701; Interrogation_Position=1033; Antisense; TTATCTCTTAGTGGCGTTTTTATTG
>probe:Drosophila_2:1631313_at:100:639; Interrogation_Position=1142; Antisense; TCTGGTTTTAATTGCCTACGTGTTA
>probe:Drosophila_2:1631313_at:151:589; Interrogation_Position=614; Antisense; TGGAGTCACTGATTGCCGCCATCCG
>probe:Drosophila_2:1631313_at:300:69; Interrogation_Position=653; Antisense; AGGCCAAGGCGTTCCTCGACGAGGC
>probe:Drosophila_2:1631313_at:331:635; Interrogation_Position=668; Antisense; TCGACGAGGCGGACAAGGCCAAGCT
>probe:Drosophila_2:1631313_at:588:119; Interrogation_Position=689; Antisense; AGCTGAAGGAGGCTCCGTTCTTTAC
>probe:Drosophila_2:1631313_at:61:473; Interrogation_Position=705; Antisense; GTTCTTTACGGAGAAGCTCTGCTCG
>probe:Drosophila_2:1631313_at:118:379; Interrogation_Position=717; Antisense; GAAGCTCTGCTCGTCGAAATAGCGA
>probe:Drosophila_2:1631313_at:14:605; Interrogation_Position=772; Antisense; TGCTGAAGGACGCACTACTACTCTT
>probe:Drosophila_2:1631313_at:604:279; Interrogation_Position=789; Antisense; CTACTCTTCGCACGGCTTTGAAATA
>probe:Drosophila_2:1631313_at:526:475; Interrogation_Position=826; Antisense; GTTATCTTATCTCTCAATTTGCGCG
>probe:Drosophila_2:1631313_at:158:163; Interrogation_Position=907; Antisense; AAATTCCTACTGCTCATAATGACAC
>probe:Drosophila_2:1631313_at:479:379; Interrogation_Position=941; Antisense; GAACCAATCGCATTTCAGTTTGATA

Paste this into a BLAST search page for me
ATGTTCCTACTGTGAATTTTTTCTATTATCTCTTAGTGGCGTTTTTATTGTCTGGTTTTAATTGCCTACGTGTTATGGAGTCACTGATTGCCGCCATCCGAGGCCAAGGCGTTCCTCGACGAGGCTCGACGAGGCGGACAAGGCCAAGCTAGCTGAAGGAGGCTCCGTTCTTTACGTTCTTTACGGAGAAGCTCTGCTCGGAAGCTCTGCTCGTCGAAATAGCGATGCTGAAGGACGCACTACTACTCTTCTACTCTTCGCACGGCTTTGAAATAGTTATCTTATCTCTCAATTTGCGCGAAATTCCTACTGCTCATAATGACACGAACCAATCGCATTTCAGTTTGATA

Full Affymetrix probeset data:

Annotations for 1631313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720