FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631317_at:

>probe:Drosophila_2:1631317_at:407:689; Interrogation_Position=1074; Antisense; TATTAGGGCTGGCTTCTTTGTTGCA
>probe:Drosophila_2:1631317_at:699:345; Interrogation_Position=1096; Antisense; GCATCTCTGGCTAATTTCGTTGGGA
>probe:Drosophila_2:1631317_at:405:501; Interrogation_Position=1124; Antisense; GTCGAACAGCCCTATCGTTGATTAC
>probe:Drosophila_2:1631317_at:598:489; Interrogation_Position=571; Antisense; GTACTAGTCACTGTCGTCGTTGTTG
>probe:Drosophila_2:1631317_at:673:281; Interrogation_Position=603; Antisense; CTCGGCAGTCGATGGCTTATTTATT
>probe:Drosophila_2:1631317_at:72:481; Interrogation_Position=630; Antisense; GTTTGCCATTAATCTGCGAGCTCAT
>probe:Drosophila_2:1631317_at:695:295; Interrogation_Position=646; Antisense; CGAGCTCATTTCCAAACACTGCAGA
>probe:Drosophila_2:1631317_at:397:527; Interrogation_Position=686; Antisense; GGGAGTTTCCTTCATCAGAACCAGA
>probe:Drosophila_2:1631317_at:345:467; Interrogation_Position=736; Antisense; GTTGAATACCACGTGCTACTCCTAT
>probe:Drosophila_2:1631317_at:552:31; Interrogation_Position=817; Antisense; ATAACCTCCTTGCAGGTTGGCGTTA
>probe:Drosophila_2:1631317_at:423:67; Interrogation_Position=865; Antisense; ATGGACTCTGTCATGGATCTCTTGC
>probe:Drosophila_2:1631317_at:14:485; Interrogation_Position=891; Antisense; GTATGCATCGTTTTTTGGTTCAATC
>probe:Drosophila_2:1631317_at:501:15; Interrogation_Position=924; Antisense; ATTATTTATCTATTGCTACGGCGGT
>probe:Drosophila_2:1631317_at:235:161; Interrogation_Position=972; Antisense; ACAAGTCGATACTGCTGTTCGGCTC

Paste this into a BLAST search page for me
TATTAGGGCTGGCTTCTTTGTTGCAGCATCTCTGGCTAATTTCGTTGGGAGTCGAACAGCCCTATCGTTGATTACGTACTAGTCACTGTCGTCGTTGTTGCTCGGCAGTCGATGGCTTATTTATTGTTTGCCATTAATCTGCGAGCTCATCGAGCTCATTTCCAAACACTGCAGAGGGAGTTTCCTTCATCAGAACCAGAGTTGAATACCACGTGCTACTCCTATATAACCTCCTTGCAGGTTGGCGTTAATGGACTCTGTCATGGATCTCTTGCGTATGCATCGTTTTTTGGTTCAATCATTATTTATCTATTGCTACGGCGGTACAAGTCGATACTGCTGTTCGGCTC

Full Affymetrix probeset data:

Annotations for 1631317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720