FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631318_at:

>probe:Drosophila_2:1631318_at:693:307; Interrogation_Position=441; Antisense; CCAGAATGACTGGACCCGGAAGGGC
>probe:Drosophila_2:1631318_at:32:333; Interrogation_Position=467; Antisense; GCTGGCGTGTGATTCACTCGCGCAA
>probe:Drosophila_2:1631318_at:273:463; Interrogation_Position=477; Antisense; GATTCACTCGCGCAAGCAGTGCGTG
>probe:Drosophila_2:1631318_at:388:503; Interrogation_Position=499; Antisense; GTGCCCGGAGATGAGGGCTATCCCA
>probe:Drosophila_2:1631318_at:187:97; Interrogation_Position=507; Antisense; AGATGAGGGCTATCCCAAGGTCTCC
>probe:Drosophila_2:1631318_at:190:567; Interrogation_Position=514; Antisense; GGCTATCCCAAGGTCTCCGATCGAT
>probe:Drosophila_2:1631318_at:302:43; Interrogation_Position=533; Antisense; ATCGATCGGCGCCTTCCGATTACGC
>probe:Drosophila_2:1631318_at:337:461; Interrogation_Position=550; Antisense; GATTACGCGGCTCGCGGATTCAACG
>probe:Drosophila_2:1631318_at:167:543; Interrogation_Position=565; Antisense; GGATTCAACGAGTCGCCGCTGAAAG
>probe:Drosophila_2:1631318_at:158:295; Interrogation_Position=573; Antisense; CGAGTCGCCGCTGAAAGCTTGAAGA
>probe:Drosophila_2:1631318_at:711:115; Interrogation_Position=588; Antisense; AGCTTGAAGAGATGATCGTCCCCGA
>probe:Drosophila_2:1631318_at:549:375; Interrogation_Position=593; Antisense; GAAGAGATGATCGTCCCCGAGCTGG
>probe:Drosophila_2:1631318_at:219:633; Interrogation_Position=606; Antisense; TCCCCGAGCTGGCTTAGTGATTTTG
>probe:Drosophila_2:1631318_at:658:513; Interrogation_Position=622; Antisense; GTGATTTTGCTTAAGTTTGAAACGT

Paste this into a BLAST search page for me
CCAGAATGACTGGACCCGGAAGGGCGCTGGCGTGTGATTCACTCGCGCAAGATTCACTCGCGCAAGCAGTGCGTGGTGCCCGGAGATGAGGGCTATCCCAAGATGAGGGCTATCCCAAGGTCTCCGGCTATCCCAAGGTCTCCGATCGATATCGATCGGCGCCTTCCGATTACGCGATTACGCGGCTCGCGGATTCAACGGGATTCAACGAGTCGCCGCTGAAAGCGAGTCGCCGCTGAAAGCTTGAAGAAGCTTGAAGAGATGATCGTCCCCGAGAAGAGATGATCGTCCCCGAGCTGGTCCCCGAGCTGGCTTAGTGATTTTGGTGATTTTGCTTAAGTTTGAAACGT

Full Affymetrix probeset data:

Annotations for 1631318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720