FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631319_at:

>probe:Drosophila_2:1631319_at:630:595; Interrogation_Position=1029; Antisense; TGTGCGGCGCCGAAATGTCGAGTTC
>probe:Drosophila_2:1631319_at:492:499; Interrogation_Position=1045; Antisense; GTCGAGTTCCGGCTTTATAACGTGG
>probe:Drosophila_2:1631319_at:559:685; Interrogation_Position=1060; Antisense; TATAACGTGGACGTGGCCCGATTGC
>probe:Drosophila_2:1631319_at:615:463; Interrogation_Position=1079; Antisense; GATTGCCCGGTGATGCCCGAAAATG
>probe:Drosophila_2:1631319_at:144:33; Interrogation_Position=575; Antisense; ATCAAACGCTCGGATGCTGCGTGGT
>probe:Drosophila_2:1631319_at:465:285; Interrogation_Position=603; Antisense; CTGTTGTGTGGCCAGTACATTCCGC
>probe:Drosophila_2:1631319_at:34:335; Interrogation_Position=651; Antisense; GCTGCTGGACGCCATCGTGGTTAAT
>probe:Drosophila_2:1631319_at:438:351; Interrogation_Position=705; Antisense; GCAGAGCGAGCGTTGGGACCTTCAT
>probe:Drosophila_2:1631319_at:432:725; Interrogation_Position=717; Antisense; TTGGGACCTTCATTCGGGTGTGGAC
>probe:Drosophila_2:1631319_at:318:409; Interrogation_Position=739; Antisense; GACGATGCCAGGTGCAACTTGAGCT
>probe:Drosophila_2:1631319_at:274:525; Interrogation_Position=774; Antisense; GGGCTCCCCAGCCAGTAGAGAAATG
>probe:Drosophila_2:1631319_at:328:53; Interrogation_Position=796; Antisense; ATGAGTTCGCTAGAGGGCCTCAACT
>probe:Drosophila_2:1631319_at:109:65; Interrogation_Position=958; Antisense; ATGGGCGCCTTCTACGTGATGCTGG
>probe:Drosophila_2:1631319_at:266:99; Interrogation_Position=995; Antisense; AGATGCTACTCTACTGCGTGGTGGT

Paste this into a BLAST search page for me
TGTGCGGCGCCGAAATGTCGAGTTCGTCGAGTTCCGGCTTTATAACGTGGTATAACGTGGACGTGGCCCGATTGCGATTGCCCGGTGATGCCCGAAAATGATCAAACGCTCGGATGCTGCGTGGTCTGTTGTGTGGCCAGTACATTCCGCGCTGCTGGACGCCATCGTGGTTAATGCAGAGCGAGCGTTGGGACCTTCATTTGGGACCTTCATTCGGGTGTGGACGACGATGCCAGGTGCAACTTGAGCTGGGCTCCCCAGCCAGTAGAGAAATGATGAGTTCGCTAGAGGGCCTCAACTATGGGCGCCTTCTACGTGATGCTGGAGATGCTACTCTACTGCGTGGTGGT

Full Affymetrix probeset data:

Annotations for 1631319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720