Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631320_at:

>probe:Drosophila_2:1631320_at:64:519; Interrogation_Position=4665; Antisense; GTGGGTCGCCCTCGAATGTGAAATC
>probe:Drosophila_2:1631320_at:609:511; Interrogation_Position=4682; Antisense; GTGAAATCAAATCGCCTGCAGGCCT
>probe:Drosophila_2:1631320_at:103:71; Interrogation_Position=4701; Antisense; AGGCCTGCAATGGAGCCATCTCTGC
>probe:Drosophila_2:1631320_at:643:321; Interrogation_Position=4735; Antisense; GCCCTCGCCGAAGAAACTGAATGCA
>probe:Drosophila_2:1631320_at:450:123; Interrogation_Position=4759; Antisense; AGCCGTGCCCACATTGGCAATTGGA
>probe:Drosophila_2:1631320_at:453:381; Interrogation_Position=4782; Antisense; GAACGCGTGCATATACGGCGGCGTT
>probe:Drosophila_2:1631320_at:730:185; Interrogation_Position=4829; Antisense; AACAAGCGGTGGTCGTTGCGCAGCA
>probe:Drosophila_2:1631320_at:499:83; Interrogation_Position=4856; Antisense; AGTGGCAACTCTGGCAATCTGATAA
>probe:Drosophila_2:1631320_at:584:659; Interrogation_Position=4878; Antisense; TAACCGCCATCAGTTGCTACAGTGA
>probe:Drosophila_2:1631320_at:727:75; Interrogation_Position=4966; Antisense; AGGAGCATCTTTGGCCGCATCCACA
>probe:Drosophila_2:1631320_at:679:45; Interrogation_Position=4984; Antisense; ATCCACAGTCGGCACGCGAAGGCGC
>probe:Drosophila_2:1631320_at:644:315; Interrogation_Position=5005; Antisense; GCGCTAGGCTAGATTGTAACGAAAC
>probe:Drosophila_2:1631320_at:78:295; Interrogation_Position=5024; Antisense; CGAAACATGCGAGCAACTTGCAAGT
>probe:Drosophila_2:1631320_at:38:183; Interrogation_Position=5184; Antisense; AAAACTGTATAAGCCGCCGCATAAA

Paste this into a BLAST search page for me
GTGGGTCGCCCTCGAATGTGAAATCGTGAAATCAAATCGCCTGCAGGCCTAGGCCTGCAATGGAGCCATCTCTGCGCCCTCGCCGAAGAAACTGAATGCAAGCCGTGCCCACATTGGCAATTGGAGAACGCGTGCATATACGGCGGCGTTAACAAGCGGTGGTCGTTGCGCAGCAAGTGGCAACTCTGGCAATCTGATAATAACCGCCATCAGTTGCTACAGTGAAGGAGCATCTTTGGCCGCATCCACAATCCACAGTCGGCACGCGAAGGCGCGCGCTAGGCTAGATTGTAACGAAACCGAAACATGCGAGCAACTTGCAAGTAAAACTGTATAAGCCGCCGCATAAA

Full Affymetrix probeset data:

Annotations for 1631320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime