Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631321_s_at:

>probe:Drosophila_2:1631321_s_at:81:41; Interrogation_Position=138; Antisense; ATCTGGATCTGCTGGCACAAAGGCA
>probe:Drosophila_2:1631321_s_at:707:171; Interrogation_Position=162; Antisense; AAAGAAAGCCTCTGCGACGCCGTCA
>probe:Drosophila_2:1631321_s_at:188:151; Interrogation_Position=186; Antisense; ACATCCGCCAACTCAGCAAATGGTG
>probe:Drosophila_2:1631321_s_at:55:357; Interrogation_Position=201; Antisense; GCAAATGGTGGACGCTTCCATTAAA
>probe:Drosophila_2:1631321_s_at:1:73; Interrogation_Position=233; Antisense; AGGAACGTGGCGGTTCATCACTTCT
>probe:Drosophila_2:1631321_s_at:190:291; Interrogation_Position=243; Antisense; CGGTTCATCACTTCTGGCAATCAAA
>probe:Drosophila_2:1631321_s_at:549:627; Interrogation_Position=279; Antisense; TGCCACTTATAAATGCGACGCCCAA
>probe:Drosophila_2:1631321_s_at:542:171; Interrogation_Position=303; Antisense; AAAGTTAGCGCCATTCATCAAGAAG
>probe:Drosophila_2:1631321_s_at:610:165; Interrogation_Position=334; Antisense; AAATCGGCCGTGGTCAATGGAAAGC
>probe:Drosophila_2:1631321_s_at:342:41; Interrogation_Position=384; Antisense; ATCTGGATCTTTCAAACTGTCGGCC
>probe:Drosophila_2:1631321_s_at:214:143; Interrogation_Position=399; Antisense; ACTGTCGGCCTCTGCCAAGAAGGAA
>probe:Drosophila_2:1631321_s_at:591:109; Interrogation_Position=494; Antisense; AGAAGATTGGTGTCTCCTCCAAAAA
>probe:Drosophila_2:1631321_s_at:245:239; Interrogation_Position=636; Antisense; AATCATAAAGTCGAAGCCCGCCGCA
>probe:Drosophila_2:1631321_s_at:425:325; Interrogation_Position=667; Antisense; GCGAAAGTGACTGCAGCGAAGCCAA

Paste this into a BLAST search page for me
ATCTGGATCTGCTGGCACAAAGGCAAAAGAAAGCCTCTGCGACGCCGTCAACATCCGCCAACTCAGCAAATGGTGGCAAATGGTGGACGCTTCCATTAAAAGGAACGTGGCGGTTCATCACTTCTCGGTTCATCACTTCTGGCAATCAAATGCCACTTATAAATGCGACGCCCAAAAAGTTAGCGCCATTCATCAAGAAGAAATCGGCCGTGGTCAATGGAAAGCATCTGGATCTTTCAAACTGTCGGCCACTGTCGGCCTCTGCCAAGAAGGAAAGAAGATTGGTGTCTCCTCCAAAAAAATCATAAAGTCGAAGCCCGCCGCAGCGAAAGTGACTGCAGCGAAGCCAA

Full Affymetrix probeset data:

Annotations for 1631321_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime