Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631323_a_at:

>probe:Drosophila_2:1631323_a_at:318:263; Interrogation_Position=1011; Antisense; CAGCGATGACCTCTTCGGCATGGAG
>probe:Drosophila_2:1631323_a_at:432:65; Interrogation_Position=1030; Antisense; ATGGAGGGCACCTTCCGGCAGCTGA
>probe:Drosophila_2:1631323_a_at:444:275; Interrogation_Position=1041; Antisense; CTTCCGGCAGCTGAACATCGACTAG
>probe:Drosophila_2:1631323_a_at:478:587; Interrogation_Position=536; Antisense; TGGACGCCATGAAGGTGGCCCTGAT
>probe:Drosophila_2:1631323_a_at:659:37; Interrogation_Position=610; Antisense; ATCTTCATCCTGGACGCGTCGGTGG
>probe:Drosophila_2:1631323_a_at:313:613; Interrogation_Position=674; Antisense; TGAAGAAGTTCCTGATCGCCGTGCA
>probe:Drosophila_2:1631323_a_at:195:617; Interrogation_Position=695; Antisense; TGCAAGAGGCCTATCCCGTGAAGGT
>probe:Drosophila_2:1631323_a_at:360:535; Interrogation_Position=726; Antisense; GGTGCATGTGATCAACATCTCGCCG
>probe:Drosophila_2:1631323_a_at:674:333; Interrogation_Position=750; Antisense; GCTGGTGGACACTATCTTCAACTTT
>probe:Drosophila_2:1631323_a_at:226:651; Interrogation_Position=767; Antisense; TCAACTTTGTGAAGCCGTTCGTGAA
>probe:Drosophila_2:1631323_a_at:14:373; Interrogation_Position=789; Antisense; GAAGGAGAAGATCCGCAGCCGCATA
>probe:Drosophila_2:1631323_a_at:498:255; Interrogation_Position=820; Antisense; CACAACGACGTGGAGAGTCTCTACA
>probe:Drosophila_2:1631323_a_at:265:639; Interrogation_Position=899; Antisense; TCGTCGAGCTGAACCAGTGGTGGAA
>probe:Drosophila_2:1631323_a_at:160:589; Interrogation_Position=932; Antisense; TGGTCGACAACACCCAGTGGTTCAA

Paste this into a BLAST search page for me
CAGCGATGACCTCTTCGGCATGGAGATGGAGGGCACCTTCCGGCAGCTGACTTCCGGCAGCTGAACATCGACTAGTGGACGCCATGAAGGTGGCCCTGATATCTTCATCCTGGACGCGTCGGTGGTGAAGAAGTTCCTGATCGCCGTGCATGCAAGAGGCCTATCCCGTGAAGGTGGTGCATGTGATCAACATCTCGCCGGCTGGTGGACACTATCTTCAACTTTTCAACTTTGTGAAGCCGTTCGTGAAGAAGGAGAAGATCCGCAGCCGCATACACAACGACGTGGAGAGTCTCTACATCGTCGAGCTGAACCAGTGGTGGAATGGTCGACAACACCCAGTGGTTCAA

Full Affymetrix probeset data:

Annotations for 1631323_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime