Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631324_at:

>probe:Drosophila_2:1631324_at:84:151; Interrogation_Position=1821; Antisense; ACATTTAATGGAGCGCCTGCTGCGG
>probe:Drosophila_2:1631324_at:97:439; Interrogation_Position=1846; Antisense; GATGGATTTTCCGTACTGAGGCAGG
>probe:Drosophila_2:1631324_at:587:607; Interrogation_Position=1862; Antisense; TGAGGCAGGATCCACGCTGCGTCTT
>probe:Drosophila_2:1631324_at:367:159; Interrogation_Position=1907; Antisense; ACAAATCCTTTGTGATGGTCGAGTG
>probe:Drosophila_2:1631324_at:179:527; Interrogation_Position=1948; Antisense; GGGAAGACCTACTGCCACGAAGAGA
>probe:Drosophila_2:1631324_at:190:459; Interrogation_Position=1983; Antisense; GATTGAAAAGGGACTGGCCACATTT
>probe:Drosophila_2:1631324_at:119:125; Interrogation_Position=2041; Antisense; AGCGCCAAGCGCGAAGGATTCTCGG
>probe:Drosophila_2:1631324_at:487:77; Interrogation_Position=2055; Antisense; AGGATTCTCGGCAAAGGACACTTTT
>probe:Drosophila_2:1631324_at:505:175; Interrogation_Position=2120; Antisense; AAACCGAATACCGAATGCCGCTCAA
>probe:Drosophila_2:1631324_at:538:395; Interrogation_Position=2146; Antisense; GACAAGATCCTGACCCTGACAAGAA
>probe:Drosophila_2:1631324_at:141:239; Interrogation_Position=2169; Antisense; AATCTGCTGGAGTGCCCTGAGTCCC
>probe:Drosophila_2:1631324_at:72:377; Interrogation_Position=2204; Antisense; GAAGCTCATCCATGCTCAAAACCTT
>probe:Drosophila_2:1631324_at:319:645; Interrogation_Position=2228; Antisense; TCTTCGCCTATCTGCCAGTTCGATA
>probe:Drosophila_2:1631324_at:687:265; Interrogation_Position=2243; Antisense; CAGTTCGATACGCAGACATGCTGAA

Paste this into a BLAST search page for me
ACATTTAATGGAGCGCCTGCTGCGGGATGGATTTTCCGTACTGAGGCAGGTGAGGCAGGATCCACGCTGCGTCTTACAAATCCTTTGTGATGGTCGAGTGGGGAAGACCTACTGCCACGAAGAGAGATTGAAAAGGGACTGGCCACATTTAGCGCCAAGCGCGAAGGATTCTCGGAGGATTCTCGGCAAAGGACACTTTTAAACCGAATACCGAATGCCGCTCAAGACAAGATCCTGACCCTGACAAGAAAATCTGCTGGAGTGCCCTGAGTCCCGAAGCTCATCCATGCTCAAAACCTTTCTTCGCCTATCTGCCAGTTCGATACAGTTCGATACGCAGACATGCTGAA

Full Affymetrix probeset data:

Annotations for 1631324_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime