FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631325_at:

>probe:Drosophila_2:1631325_at:225:321; Interrogation_Position=1043; Antisense; GCCCCGACTGCGAGAAATCGTTCGT
>probe:Drosophila_2:1631325_at:438:371; Interrogation_Position=1083; Antisense; GAAGGTGCACAAGCGGGTCCACCAG
>probe:Drosophila_2:1631325_at:562:127; Interrogation_Position=1103; Antisense; ACCAGCCGGTCGAGAAGCCAGAGTC
>probe:Drosophila_2:1631325_at:637:377; Interrogation_Position=1141; Antisense; GAAGCCACCGTCACGTTCTTTTAGG
>probe:Drosophila_2:1631325_at:617:81; Interrogation_Position=1163; Antisense; AGGGTAGTCCTTTGCTAGATTAATC
>probe:Drosophila_2:1631325_at:245:109; Interrogation_Position=1190; Antisense; AGAAGCCCAGCTCATGGGTGCATTA
>probe:Drosophila_2:1631325_at:469:345; Interrogation_Position=1209; Antisense; GCATTAGCGCGCGTATGTATCATAA
>probe:Drosophila_2:1631325_at:467:33; Interrogation_Position=661; Antisense; ATCAAGGCGGACACCTGCCAGAAGA
>probe:Drosophila_2:1631325_at:510:261; Interrogation_Position=696; Antisense; CACCTGCAACGTGTGTGGCTTGAAA
>probe:Drosophila_2:1631325_at:53:139; Interrogation_Position=731; Antisense; ACGAGGTACTCGATCTGCATATGAA
>probe:Drosophila_2:1631325_at:572:263; Interrogation_Position=773; Antisense; CAGAACTTGAATGCCGCTACTGCGA
>probe:Drosophila_2:1631325_at:495:443; Interrogation_Position=906; Antisense; GATGTACAACCATCTGATGCGCCAC
>probe:Drosophila_2:1631325_at:211:423; Interrogation_Position=940; Antisense; GAGAACGCCCTGATCTGCGAGGTGT
>probe:Drosophila_2:1631325_at:392:435; Interrogation_Position=958; Antisense; GAGGTGTGCCACCAGCAGTTCAAGA

Paste this into a BLAST search page for me
GCCCCGACTGCGAGAAATCGTTCGTGAAGGTGCACAAGCGGGTCCACCAGACCAGCCGGTCGAGAAGCCAGAGTCGAAGCCACCGTCACGTTCTTTTAGGAGGGTAGTCCTTTGCTAGATTAATCAGAAGCCCAGCTCATGGGTGCATTAGCATTAGCGCGCGTATGTATCATAAATCAAGGCGGACACCTGCCAGAAGACACCTGCAACGTGTGTGGCTTGAAAACGAGGTACTCGATCTGCATATGAACAGAACTTGAATGCCGCTACTGCGAGATGTACAACCATCTGATGCGCCACGAGAACGCCCTGATCTGCGAGGTGTGAGGTGTGCCACCAGCAGTTCAAGA

Full Affymetrix probeset data:

Annotations for 1631325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720