FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631326_at:

>probe:Drosophila_2:1631326_at:463:447; Interrogation_Position=532; Antisense; GATCCACAGTTCCAATTTTCATCGA
>probe:Drosophila_2:1631326_at:271:155; Interrogation_Position=537; Antisense; ACAGTTCCAATTTTCATCGATCTAT
>probe:Drosophila_2:1631326_at:10:271; Interrogation_Position=551; Antisense; CATCGATCTATCTTTCCTGGAACAA
>probe:Drosophila_2:1631326_at:551:157; Interrogation_Position=572; Antisense; ACAAAAACGTATTATTCTGGAGCAA
>probe:Drosophila_2:1631326_at:278:291; Interrogation_Position=579; Antisense; CGTATTATTCTGGAGCAACAAAAGC
>probe:Drosophila_2:1631326_at:404:251; Interrogation_Position=597; Antisense; CAAAAGCAAAAAGACCAACTGGCAG
>probe:Drosophila_2:1631326_at:261:287; Interrogation_Position=615; Antisense; CTGGCAGAGCAACAACGTCAACAAC
>probe:Drosophila_2:1631326_at:222:495; Interrogation_Position=631; Antisense; GTCAACAACGCCAGCATCAACTGCA
>probe:Drosophila_2:1631326_at:81:347; Interrogation_Position=644; Antisense; GCATCAACTGCAAATACTCTATCAA
>probe:Drosophila_2:1631326_at:114:231; Interrogation_Position=676; Antisense; AATGATCAATCAAATAGTAGCCAAA
>probe:Drosophila_2:1631326_at:723:483; Interrogation_Position=692; Antisense; GTAGCCAAAAACTGAACCCACTTCT
>probe:Drosophila_2:1631326_at:200:381; Interrogation_Position=705; Antisense; GAACCCACTTCTAATAGACTATGAG
>probe:Drosophila_2:1631326_at:48:105; Interrogation_Position=720; Antisense; AGACTATGAGCCAAATACCCTTTCC
>probe:Drosophila_2:1631326_at:382:55; Interrogation_Position=725; Antisense; ATGAGCCAAATACCCTTTCCCAAGA

Paste this into a BLAST search page for me
GATCCACAGTTCCAATTTTCATCGAACAGTTCCAATTTTCATCGATCTATCATCGATCTATCTTTCCTGGAACAAACAAAAACGTATTATTCTGGAGCAACGTATTATTCTGGAGCAACAAAAGCCAAAAGCAAAAAGACCAACTGGCAGCTGGCAGAGCAACAACGTCAACAACGTCAACAACGCCAGCATCAACTGCAGCATCAACTGCAAATACTCTATCAAAATGATCAATCAAATAGTAGCCAAAGTAGCCAAAAACTGAACCCACTTCTGAACCCACTTCTAATAGACTATGAGAGACTATGAGCCAAATACCCTTTCCATGAGCCAAATACCCTTTCCCAAGA

Full Affymetrix probeset data:

Annotations for 1631326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720