Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631327_at:

>probe:Drosophila_2:1631327_at:121:447; Interrogation_Position=2027; Antisense; GATGCATCGCTACCGCAAGGTCATA
>probe:Drosophila_2:1631327_at:489:113; Interrogation_Position=2092; Antisense; AGCAGTCCAAGTGGTGCGGCACCGA
>probe:Drosophila_2:1631327_at:314:567; Interrogation_Position=2109; Antisense; GGCACCGAGCGCAACTGTCACGGGT
>probe:Drosophila_2:1631327_at:328:495; Interrogation_Position=2125; Antisense; GTCACGGGTCGCAGACCTATTTTAA
>probe:Drosophila_2:1631327_at:278:249; Interrogation_Position=2148; Antisense; AATTGGTCCGATTCCGACACATGAA
>probe:Drosophila_2:1631327_at:729:397; Interrogation_Position=2163; Antisense; GACACATGAACGATCCACTTGGCGG
>probe:Drosophila_2:1631327_at:111:311; Interrogation_Position=2177; Antisense; CCACTTGGCGGAGGCACAGGCGATA
>probe:Drosophila_2:1631327_at:144:363; Interrogation_Position=2229; Antisense; GAATTGCTTTTTCTGTGTGAACAAG
>probe:Drosophila_2:1631327_at:642:167; Interrogation_Position=2254; Antisense; AAAGACCAGCCAGGCCGTTAGGAGT
>probe:Drosophila_2:1631327_at:585:81; Interrogation_Position=2276; Antisense; AGTGTGGTTCATCCCGCAAGGAGAT
>probe:Drosophila_2:1631327_at:457:401; Interrogation_Position=2327; Antisense; GACATTGTTTTTAACGCAGACGGCA
>probe:Drosophila_2:1631327_at:186:135; Interrogation_Position=2340; Antisense; ACGCAGACGGCAGAGACTTCAATTA
>probe:Drosophila_2:1631327_at:663:541; Interrogation_Position=2450; Antisense; GGATTGGAGTCATTCGTCCTGCGGA
>probe:Drosophila_2:1631327_at:65:291; Interrogation_Position=2464; Antisense; CGTCCTGCGGATGTCGATTCAAACA

Paste this into a BLAST search page for me
GATGCATCGCTACCGCAAGGTCATAAGCAGTCCAAGTGGTGCGGCACCGAGGCACCGAGCGCAACTGTCACGGGTGTCACGGGTCGCAGACCTATTTTAAAATTGGTCCGATTCCGACACATGAAGACACATGAACGATCCACTTGGCGGCCACTTGGCGGAGGCACAGGCGATAGAATTGCTTTTTCTGTGTGAACAAGAAAGACCAGCCAGGCCGTTAGGAGTAGTGTGGTTCATCCCGCAAGGAGATGACATTGTTTTTAACGCAGACGGCAACGCAGACGGCAGAGACTTCAATTAGGATTGGAGTCATTCGTCCTGCGGACGTCCTGCGGATGTCGATTCAAACA

Full Affymetrix probeset data:

Annotations for 1631327_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime