Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631330_at:

>probe:Drosophila_2:1631330_at:322:725; Interrogation_Position=1321; Antisense; TTGATAGACACTAAGCCCACTACGT
>probe:Drosophila_2:1631330_at:327:205; Interrogation_Position=1333; Antisense; AAGCCCACTACGTCCATTGAAGGGA
>probe:Drosophila_2:1631330_at:714:487; Interrogation_Position=1384; Antisense; GTACTCCGCAACTTAAGAGGCCACT
>probe:Drosophila_2:1631330_at:522:437; Interrogation_Position=1400; Antisense; GAGGCCACTTTAAAGACACCGAACT
>probe:Drosophila_2:1631330_at:673:239; Interrogation_Position=1431; Antisense; AATCACTCAGCTCAATCGAACTCAG
>probe:Drosophila_2:1631330_at:627:441; Interrogation_Position=1455; Antisense; GATGAATCTACAGCTAACCTAACCA
>probe:Drosophila_2:1631330_at:438:27; Interrogation_Position=1479; Antisense; ATAGCTCAAGCTCAACTCCATAGTA
>probe:Drosophila_2:1631330_at:472:567; Interrogation_Position=1511; Antisense; GGCAGTTCCAAACTAGCCAAAGCAT
>probe:Drosophila_2:1631330_at:474:649; Interrogation_Position=1553; Antisense; TCAGACCAGACATCCTCGTATTATT
>probe:Drosophila_2:1631330_at:56:639; Interrogation_Position=1611; Antisense; TCGATTCGAATCAACTCACCTACAA
>probe:Drosophila_2:1631330_at:391:487; Interrogation_Position=1641; Antisense; GTACTATAACCGTGTGCAATTCCCA
>probe:Drosophila_2:1631330_at:350:517; Interrogation_Position=1652; Antisense; GTGTGCAATTCCCATCTTATTTCTA
>probe:Drosophila_2:1631330_at:623:247; Interrogation_Position=1688; Antisense; AATTGTATTCATGTTAGCCCGACCA
>probe:Drosophila_2:1631330_at:72:475; Interrogation_Position=1700; Antisense; GTTAGCCCGACCATTTTACATTTGT

Paste this into a BLAST search page for me
TTGATAGACACTAAGCCCACTACGTAAGCCCACTACGTCCATTGAAGGGAGTACTCCGCAACTTAAGAGGCCACTGAGGCCACTTTAAAGACACCGAACTAATCACTCAGCTCAATCGAACTCAGGATGAATCTACAGCTAACCTAACCAATAGCTCAAGCTCAACTCCATAGTAGGCAGTTCCAAACTAGCCAAAGCATTCAGACCAGACATCCTCGTATTATTTCGATTCGAATCAACTCACCTACAAGTACTATAACCGTGTGCAATTCCCAGTGTGCAATTCCCATCTTATTTCTAAATTGTATTCATGTTAGCCCGACCAGTTAGCCCGACCATTTTACATTTGT

Full Affymetrix probeset data:

Annotations for 1631330_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime