Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631333_s_at:

>probe:Drosophila_2:1631333_s_at:2:273; Interrogation_Position=1011; Antisense; CTCACATTCTTCTCCTAATACGATA
>probe:Drosophila_2:1631333_s_at:4:289; Interrogation_Position=490; Antisense; CGGCCATTCTGGACTTCTGGGACAA
>probe:Drosophila_2:1631333_s_at:564:535; Interrogation_Position=525; Antisense; GGTCCCGGTGGTATCATCTGCAACA
>probe:Drosophila_2:1631333_s_at:656:39; Interrogation_Position=540; Antisense; ATCTGCAACATTGGATCCGTCACTG
>probe:Drosophila_2:1631333_s_at:467:543; Interrogation_Position=564; Antisense; GGATTCAATGCCATCTACCAGGTGC
>probe:Drosophila_2:1631333_s_at:40:289; Interrogation_Position=659; Antisense; CGGCGTGACGGCTTACACTGTGAAC
>probe:Drosophila_2:1631333_s_at:682:591; Interrogation_Position=706; Antisense; TGGTGCACACGTTCAACTCCTGGTT
>probe:Drosophila_2:1631333_s_at:573:145; Interrogation_Position=721; Antisense; ACTCCTGGTTGGATGTTGAGCCTCA
>probe:Drosophila_2:1631333_s_at:93:725; Interrogation_Position=736; Antisense; TTGAGCCTCAGGTTGCCGAGAAGCT
>probe:Drosophila_2:1631333_s_at:670:383; Interrogation_Position=800; Antisense; GAACTTCGTCAAGGCTATCGAGCTG
>probe:Drosophila_2:1631333_s_at:399:559; Interrogation_Position=844; Antisense; GGAAACTGGACTTGGGCACCCTGGA
>probe:Drosophila_2:1631333_s_at:249:589; Interrogation_Position=865; Antisense; TGGAGGCCATCCAGTGGACCAAGCA
>probe:Drosophila_2:1631333_s_at:311:285; Interrogation_Position=890; Antisense; CTGGGACTCCGGCATCTAAGAAGTG
>probe:Drosophila_2:1631333_s_at:612:225; Interrogation_Position=992; Antisense; AAGGCTGATTCGATGCACACTCACA

Paste this into a BLAST search page for me
CTCACATTCTTCTCCTAATACGATACGGCCATTCTGGACTTCTGGGACAAGGTCCCGGTGGTATCATCTGCAACAATCTGCAACATTGGATCCGTCACTGGGATTCAATGCCATCTACCAGGTGCCGGCGTGACGGCTTACACTGTGAACTGGTGCACACGTTCAACTCCTGGTTACTCCTGGTTGGATGTTGAGCCTCATTGAGCCTCAGGTTGCCGAGAAGCTGAACTTCGTCAAGGCTATCGAGCTGGGAAACTGGACTTGGGCACCCTGGATGGAGGCCATCCAGTGGACCAAGCACTGGGACTCCGGCATCTAAGAAGTGAAGGCTGATTCGATGCACACTCACA

Full Affymetrix probeset data:

Annotations for 1631333_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime