Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631335_a_at:

>probe:Drosophila_2:1631335_a_at:438:345; Interrogation_Position=136; Antisense; GCATTCTCGAGAAGGTGATTCACCA
>probe:Drosophila_2:1631335_a_at:30:43; Interrogation_Position=171; Antisense; ATCGTGGATCGCATTCTATCGGAAC
>probe:Drosophila_2:1631335_a_at:108:147; Interrogation_Position=198; Antisense; ACTATTGGGTATGTGGTGTCCGATA
>probe:Drosophila_2:1631335_a_at:274:51; Interrogation_Position=232; Antisense; ATGCGGTGGCCGAAACATCCTTCGA
>probe:Drosophila_2:1631335_a_at:584:269; Interrogation_Position=247; Antisense; CATCCTTCGATAACACAAGTGCCCA
>probe:Drosophila_2:1631335_a_at:112:221; Interrogation_Position=263; Antisense; AAGTGCCCAGGCGATCCTGAAGCAC
>probe:Drosophila_2:1631335_a_at:93:615; Interrogation_Position=280; Antisense; TGAAGCACTTACATGGACTCCTGGT
>probe:Drosophila_2:1631335_a_at:711:591; Interrogation_Position=301; Antisense; TGGTGAGCACCTGCCAAAGCGTAGT
>probe:Drosophila_2:1631335_a_at:44:283; Interrogation_Position=311; Antisense; CTGCCAAAGCGTAGTCCGGGACATT
>probe:Drosophila_2:1631335_a_at:525:185; Interrogation_Position=345; Antisense; AACAAACTCTGCTTCATGCGCCTGG
>probe:Drosophila_2:1631335_a_at:621:251; Interrogation_Position=377; Antisense; CAAGTTCGAGTATCTGGTGGCCCCA
>probe:Drosophila_2:1631335_a_at:24:321; Interrogation_Position=396; Antisense; GCCCCAGAGGAGTACTTCACCATTA
>probe:Drosophila_2:1631335_a_at:287:645; Interrogation_Position=466; Antisense; TCATGCGAGTTGAACGATTCCGGAA
>probe:Drosophila_2:1631335_a_at:582:183; Interrogation_Position=542; Antisense; AACAATTTCCTACAACTGGGTCAAG

Paste this into a BLAST search page for me
GCATTCTCGAGAAGGTGATTCACCAATCGTGGATCGCATTCTATCGGAACACTATTGGGTATGTGGTGTCCGATAATGCGGTGGCCGAAACATCCTTCGACATCCTTCGATAACACAAGTGCCCAAAGTGCCCAGGCGATCCTGAAGCACTGAAGCACTTACATGGACTCCTGGTTGGTGAGCACCTGCCAAAGCGTAGTCTGCCAAAGCGTAGTCCGGGACATTAACAAACTCTGCTTCATGCGCCTGGCAAGTTCGAGTATCTGGTGGCCCCAGCCCCAGAGGAGTACTTCACCATTATCATGCGAGTTGAACGATTCCGGAAAACAATTTCCTACAACTGGGTCAAG

Full Affymetrix probeset data:

Annotations for 1631335_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime