FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631337_at:

>probe:Drosophila_2:1631337_at:422:161; Interrogation_Position=118; Antisense; AAATTGGCCGCCTATTATGGCAAAC
>probe:Drosophila_2:1631337_at:537:681; Interrogation_Position=133; Antisense; TATGGCAAACTCTGCCGCAATGTGG
>probe:Drosophila_2:1631337_at:310:361; Interrogation_Position=149; Antisense; GCAATGTGGGCACCAAGGCTATCAT
>probe:Drosophila_2:1631337_at:143:227; Interrogation_Position=163; Antisense; AAGGCTATCATGCACATGGCCCCGG
>probe:Drosophila_2:1631337_at:385:205; Interrogation_Position=193; Antisense; AAGCGTTCCCTGTGCAGGCGCTGTT
>probe:Drosophila_2:1631337_at:533:273; Interrogation_Position=220; Antisense; CTTCCCCTGATTCCCGGAGTGAATA
>probe:Drosophila_2:1631337_at:131:215; Interrogation_Position=28; Antisense; AAGATGAAGCACCTGACCCAGCGGG
>probe:Drosophila_2:1631337_at:308:607; Interrogation_Position=285; Antisense; TGATGCACAAGCTCAATCGAACGGA
>probe:Drosophila_2:1631337_at:704:485; Interrogation_Position=416; Antisense; GTACTGAACAGGTCTCTTTTTTCTT
>probe:Drosophila_2:1631337_at:232:289; Interrogation_Position=463; Antisense; CGGCGAAGCTTTGCGGCGAACAGTC
>probe:Drosophila_2:1631337_at:368:553; Interrogation_Position=504; Antisense; GGAGCAGCCGCAATCCATAGTGCAA
>probe:Drosophila_2:1631337_at:15:85; Interrogation_Position=528; Antisense; AGTGGTCTCGCTCCCCAAAGAGAAA
>probe:Drosophila_2:1631337_at:317:649; Interrogation_Position=61; Antisense; TCACGCATGAACTACCTGTTCCAGG
>probe:Drosophila_2:1631337_at:540:303; Interrogation_Position=75; Antisense; CCTGTTCCAGGCCTCGAATTTAATG

Paste this into a BLAST search page for me
AAATTGGCCGCCTATTATGGCAAACTATGGCAAACTCTGCCGCAATGTGGGCAATGTGGGCACCAAGGCTATCATAAGGCTATCATGCACATGGCCCCGGAAGCGTTCCCTGTGCAGGCGCTGTTCTTCCCCTGATTCCCGGAGTGAATAAAGATGAAGCACCTGACCCAGCGGGTGATGCACAAGCTCAATCGAACGGAGTACTGAACAGGTCTCTTTTTTCTTCGGCGAAGCTTTGCGGCGAACAGTCGGAGCAGCCGCAATCCATAGTGCAAAGTGGTCTCGCTCCCCAAAGAGAAATCACGCATGAACTACCTGTTCCAGGCCTGTTCCAGGCCTCGAATTTAATG

Full Affymetrix probeset data:

Annotations for 1631337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720