Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631340_at:

>probe:Drosophila_2:1631340_at:124:185; Interrogation_Position=2018; Antisense; AAAATGTGGTCCAAAGCCGCCATTG
>probe:Drosophila_2:1631340_at:194:321; Interrogation_Position=2033; Antisense; GCCGCCATTGCGAAAGGCTTTCATG
>probe:Drosophila_2:1631340_at:687:63; Interrogation_Position=2055; Antisense; ATGGGAGCCGCCCTATCAATCGAAA
>probe:Drosophila_2:1631340_at:55:195; Interrogation_Position=2078; Antisense; AACTGCAGTCGGTTACGGGAGTCCT
>probe:Drosophila_2:1631340_at:202:549; Interrogation_Position=2095; Antisense; GGAGTCCTCCCAGTTTCTGCTTAAA
>probe:Drosophila_2:1631340_at:212:149; Interrogation_Position=2119; Antisense; ACATTCCGCATTCAACAGTTTTCGA
>probe:Drosophila_2:1631340_at:633:475; Interrogation_Position=2136; Antisense; GTTTTCGATCCAACGGACACTTTGC
>probe:Drosophila_2:1631340_at:148:601; Interrogation_Position=2187; Antisense; TGTTATTAGCCCGAGGACAGCCGAA
>probe:Drosophila_2:1631340_at:447:69; Interrogation_Position=2223; Antisense; AGCACGGATGGTTTGGTTTCGTCCT
>probe:Drosophila_2:1631340_at:194:479; Interrogation_Position=2238; Antisense; GTTTCGTCCTCAGATGTGTCATTTT
>probe:Drosophila_2:1631340_at:445:569; Interrogation_Position=2306; Antisense; GGCATTAGATGCACACGTACTCAAA
>probe:Drosophila_2:1631340_at:659:665; Interrogation_Position=2350; Antisense; TACACTTTAACACCTTTCACTTCAA
>probe:Drosophila_2:1631340_at:716:555; Interrogation_Position=2441; Antisense; GGACGAGTCCTCACAAATATTATTG
>probe:Drosophila_2:1631340_at:426:95; Interrogation_Position=2560; Antisense; AGATTCGTTATCTAGCGGTGGCACC

Paste this into a BLAST search page for me
AAAATGTGGTCCAAAGCCGCCATTGGCCGCCATTGCGAAAGGCTTTCATGATGGGAGCCGCCCTATCAATCGAAAAACTGCAGTCGGTTACGGGAGTCCTGGAGTCCTCCCAGTTTCTGCTTAAAACATTCCGCATTCAACAGTTTTCGAGTTTTCGATCCAACGGACACTTTGCTGTTATTAGCCCGAGGACAGCCGAAAGCACGGATGGTTTGGTTTCGTCCTGTTTCGTCCTCAGATGTGTCATTTTGGCATTAGATGCACACGTACTCAAATACACTTTAACACCTTTCACTTCAAGGACGAGTCCTCACAAATATTATTGAGATTCGTTATCTAGCGGTGGCACC

Full Affymetrix probeset data:

Annotations for 1631340_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime