Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631342_at:

>probe:Drosophila_2:1631342_at:230:377; Interrogation_Position=1024; Antisense; GAAGCAAAAGCTGCCGTCTCAACTG
>probe:Drosophila_2:1631342_at:695:317; Interrogation_Position=1036; Antisense; GCCGTCTCAACTGCAATAGCTAAAT
>probe:Drosophila_2:1631342_at:81:25; Interrogation_Position=1059; Antisense; ATATGCATTTTTCGTTGTTAATAGC
>probe:Drosophila_2:1631342_at:639:653; Interrogation_Position=1094; Antisense; TAATTTACTATGGTTCCGACACAAA
>probe:Drosophila_2:1631342_at:84:63; Interrogation_Position=1132; Antisense; ATGGGATTGATAATATTCGGCTTTA
>probe:Drosophila_2:1631342_at:187:25; Interrogation_Position=1239; Antisense; ATATGTGCGAACTGAGCGAACGTGC
>probe:Drosophila_2:1631342_at:220:291; Interrogation_Position=1259; Antisense; CGTGCAGACATTTCAATACCCGATC
>probe:Drosophila_2:1631342_at:127:47; Interrogation_Position=1281; Antisense; ATCCGCTTGATCCTTCGTGAGCAGA
>probe:Drosophila_2:1631342_at:301:87; Interrogation_Position=808; Antisense; AGTCAATCACCCCTACGAGAACAAC
>probe:Drosophila_2:1631342_at:686:163; Interrogation_Position=884; Antisense; AAATAAATCCGCTAACTCTGTCGCT
>probe:Drosophila_2:1631342_at:142:341; Interrogation_Position=910; Antisense; GCTTGTCCCACGCAAACGAAATGTA
>probe:Drosophila_2:1631342_at:453:43; Interrogation_Position=945; Antisense; ATCGAAGTTGATGGTCGGACCGGAC
>probe:Drosophila_2:1631342_at:450:453; Interrogation_Position=983; Antisense; GATCTATTTGTCTGCGATTCTCAAC
>probe:Drosophila_2:1631342_at:605:461; Interrogation_Position=998; Antisense; GATTCTCAACTTCCCAGCGTGGTGA

Paste this into a BLAST search page for me
GAAGCAAAAGCTGCCGTCTCAACTGGCCGTCTCAACTGCAATAGCTAAATATATGCATTTTTCGTTGTTAATAGCTAATTTACTATGGTTCCGACACAAAATGGGATTGATAATATTCGGCTTTAATATGTGCGAACTGAGCGAACGTGCCGTGCAGACATTTCAATACCCGATCATCCGCTTGATCCTTCGTGAGCAGAAGTCAATCACCCCTACGAGAACAACAAATAAATCCGCTAACTCTGTCGCTGCTTGTCCCACGCAAACGAAATGTAATCGAAGTTGATGGTCGGACCGGACGATCTATTTGTCTGCGATTCTCAACGATTCTCAACTTCCCAGCGTGGTGA

Full Affymetrix probeset data:

Annotations for 1631342_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime