FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631343_at:

>probe:Drosophila_2:1631343_at:655:649; Interrogation_Position=110; Antisense; TCACAGCCGAGGATCGTAGCTCTAT
>probe:Drosophila_2:1631343_at:561:241; Interrogation_Position=184; Antisense; AATATAACAACCACATTGCCGCCAA
>probe:Drosophila_2:1631343_at:456:369; Interrogation_Position=213; Antisense; GAATGGCACTACCTTGGAGACCACT
>probe:Drosophila_2:1631343_at:587:667; Interrogation_Position=237; Antisense; TACTCTGGCACCTGGAAATTCCACA
>probe:Drosophila_2:1631343_at:431:239; Interrogation_Position=25; Antisense; AATAGGGATCATCACTTCGCGTTTC
>probe:Drosophila_2:1631343_at:30:513; Interrogation_Position=265; Antisense; GTGACCACAGAGGTTTCGCAAACAT
>probe:Drosophila_2:1631343_at:671:179; Interrogation_Position=284; Antisense; AAACATCTACTAACTCCACATCGAG
>probe:Drosophila_2:1631343_at:66:433; Interrogation_Position=306; Antisense; GAGTGCCTTGGATACGACCACGAGC
>probe:Drosophila_2:1631343_at:86:415; Interrogation_Position=321; Antisense; GACCACGAGCAGTTTGAATTCCACA
>probe:Drosophila_2:1631343_at:499:165; Interrogation_Position=390; Antisense; AAATCCCACTACTATGAGGCGCAGG
>probe:Drosophila_2:1631343_at:699:717; Interrogation_Position=40; Antisense; TTCGCGTTTCTAATGATCGTTGCCC
>probe:Drosophila_2:1631343_at:584:459; Interrogation_Position=414; Antisense; GATTTGCTTCAAGCGTTTCTGCTAC
>probe:Drosophila_2:1631343_at:684:625; Interrogation_Position=60; Antisense; TGCCCTCGTGGGAAGTAGCTGTATT
>probe:Drosophila_2:1631343_at:76:689; Interrogation_Position=85; Antisense; TTAGGATTTTCCGATGCCCAAACCT

Paste this into a BLAST search page for me
TCACAGCCGAGGATCGTAGCTCTATAATATAACAACCACATTGCCGCCAAGAATGGCACTACCTTGGAGACCACTTACTCTGGCACCTGGAAATTCCACAAATAGGGATCATCACTTCGCGTTTCGTGACCACAGAGGTTTCGCAAACATAAACATCTACTAACTCCACATCGAGGAGTGCCTTGGATACGACCACGAGCGACCACGAGCAGTTTGAATTCCACAAAATCCCACTACTATGAGGCGCAGGTTCGCGTTTCTAATGATCGTTGCCCGATTTGCTTCAAGCGTTTCTGCTACTGCCCTCGTGGGAAGTAGCTGTATTTTAGGATTTTCCGATGCCCAAACCT

Full Affymetrix probeset data:

Annotations for 1631343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720