FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631344_at:

>probe:Drosophila_2:1631344_at:503:549; Interrogation_Position=1045; Antisense; GGAGGATCCATTACGCCCAAGACAA
>probe:Drosophila_2:1631344_at:116:123; Interrogation_Position=1094; Antisense; AGCGAACTCCACTCAGTTGCGTTAA
>probe:Drosophila_2:1631344_at:524:39; Interrogation_Position=1130; Antisense; ATCTGCGATCCCGTTCAATGGAAAA
>probe:Drosophila_2:1631344_at:50:377; Interrogation_Position=1164; Antisense; GAAGAATCAGATTCCGCCCGCGCAG
>probe:Drosophila_2:1631344_at:323:101; Interrogation_Position=1187; Antisense; AGAGCTTCAACGATCAACTGCGGAT
>probe:Drosophila_2:1631344_at:50:195; Interrogation_Position=1202; Antisense; AACTGCGGATAATCTCTGGCACAGA
>probe:Drosophila_2:1631344_at:465:81; Interrogation_Position=1223; Antisense; CAGAGGGATTCAGCGGACCCGTTTA
>probe:Drosophila_2:1631344_at:540:555; Interrogation_Position=1237; Antisense; GGACCCGTTTACTAACACAGCTTAG
>probe:Drosophila_2:1631344_at:450:487; Interrogation_Position=1261; Antisense; GTAGCTACTATTGCCTTATGTCCAT
>probe:Drosophila_2:1631344_at:459:309; Interrogation_Position=1292; Antisense; CCACCAAATCATAGTCTTTTCTCAC
>probe:Drosophila_2:1631344_at:137:37; Interrogation_Position=781; Antisense; ATCATCTTCTGCGACGACGAGGAGG
>probe:Drosophila_2:1631344_at:598:609; Interrogation_Position=851; Antisense; TGACCCTGAATCTCAGCACTGGCAG
>probe:Drosophila_2:1631344_at:130:117; Interrogation_Position=908; Antisense; AGCTACCAGAAGTGCCGTCGAACAA
>probe:Drosophila_2:1631344_at:507:71; Interrogation_Position=945; Antisense; AGTGCGTTTGGGTCACAAGCGTCGT

Paste this into a BLAST search page for me
GGAGGATCCATTACGCCCAAGACAAAGCGAACTCCACTCAGTTGCGTTAAATCTGCGATCCCGTTCAATGGAAAAGAAGAATCAGATTCCGCCCGCGCAGAGAGCTTCAACGATCAACTGCGGATAACTGCGGATAATCTCTGGCACAGACAGAGGGATTCAGCGGACCCGTTTAGGACCCGTTTACTAACACAGCTTAGGTAGCTACTATTGCCTTATGTCCATCCACCAAATCATAGTCTTTTCTCACATCATCTTCTGCGACGACGAGGAGGTGACCCTGAATCTCAGCACTGGCAGAGCTACCAGAAGTGCCGTCGAACAAAGTGCGTTTGGGTCACAAGCGTCGT

Full Affymetrix probeset data:

Annotations for 1631344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720