Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631346_a_at:

>probe:Drosophila_2:1631346_a_at:181:121; Interrogation_Position=1012; Antisense; AGCTGTGTCATTTTATTGCGTCATT
>probe:Drosophila_2:1631346_a_at:558:677; Interrogation_Position=1063; Antisense; TAGATTCTGGTATGCTGTGGTCAAA
>probe:Drosophila_2:1631346_a_at:449:643; Interrogation_Position=1104; Antisense; TCTCCATTCGCACTGAGCTGTAATT
>probe:Drosophila_2:1631346_a_at:28:185; Interrogation_Position=1150; Antisense; AAAATCCGTCCATGTGATACTCCAA
>probe:Drosophila_2:1631346_a_at:303:331; Interrogation_Position=675; Antisense; GCGGAGATCCAATGACTTTCGCTCG
>probe:Drosophila_2:1631346_a_at:68:337; Interrogation_Position=695; Antisense; GCTCGCCGGCGGAACTTAGTGAGAT
>probe:Drosophila_2:1631346_a_at:64:225; Interrogation_Position=733; Antisense; AAGGAGTTCATAGATCCCGCTCAGT
>probe:Drosophila_2:1631346_a_at:571:37; Interrogation_Position=778; Antisense; ATCTTCGCCGAGGTGTTCATGCGCT
>probe:Drosophila_2:1631346_a_at:316:401; Interrogation_Position=811; Antisense; GACTATTCCGTGGAACCCTCGAGAA
>probe:Drosophila_2:1631346_a_at:558:189; Interrogation_Position=853; Antisense; AACAGTCGCTGCATGGGCCAGTGGC
>probe:Drosophila_2:1631346_a_at:119:223; Interrogation_Position=892; Antisense; AAGGTGGTGCGTTTCGACATCCTCA
>probe:Drosophila_2:1631346_a_at:467:333; Interrogation_Position=927; Antisense; GCTGTTCGATATTCCCGAGTTCGAG
>probe:Drosophila_2:1631346_a_at:375:505; Interrogation_Position=972; Antisense; GTCCAGGATGGGTCGCAGCTTTGAA
>probe:Drosophila_2:1631346_a_at:579:99; Interrogation_Position=998; Antisense; AGAGTGCTTCTAGCAGCTGTGTCAT

Paste this into a BLAST search page for me
AGCTGTGTCATTTTATTGCGTCATTTAGATTCTGGTATGCTGTGGTCAAATCTCCATTCGCACTGAGCTGTAATTAAAATCCGTCCATGTGATACTCCAAGCGGAGATCCAATGACTTTCGCTCGGCTCGCCGGCGGAACTTAGTGAGATAAGGAGTTCATAGATCCCGCTCAGTATCTTCGCCGAGGTGTTCATGCGCTGACTATTCCGTGGAACCCTCGAGAAAACAGTCGCTGCATGGGCCAGTGGCAAGGTGGTGCGTTTCGACATCCTCAGCTGTTCGATATTCCCGAGTTCGAGGTCCAGGATGGGTCGCAGCTTTGAAAGAGTGCTTCTAGCAGCTGTGTCAT

Full Affymetrix probeset data:

Annotations for 1631346_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime