Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631347_at:

>probe:Drosophila_2:1631347_at:473:309; Interrogation_Position=1009; Antisense; CCAACGTCGCAGTGAGAGGTCTATA
>probe:Drosophila_2:1631347_at:118:73; Interrogation_Position=1047; Antisense; AGGAAGATTACCATACTCCTCTGCC
>probe:Drosophila_2:1631347_at:324:397; Interrogation_Position=1073; Antisense; GACAACCGACACGAGCTAACTGTAA
>probe:Drosophila_2:1631347_at:415:499; Interrogation_Position=1117; Antisense; GTCGGTGAACCCACAAATTCTCTGA
>probe:Drosophila_2:1631347_at:477:405; Interrogation_Position=632; Antisense; GACTGCGCTGCCCACATGTTGGATC
>probe:Drosophila_2:1631347_at:623:545; Interrogation_Position=652; Antisense; GGATCCCTTGGACTTGAACAGCATC
>probe:Drosophila_2:1631347_at:252:385; Interrogation_Position=667; Antisense; GAACAGCATCGAGTACTATCAGAAG
>probe:Drosophila_2:1631347_at:723:189; Interrogation_Position=734; Antisense; AACATGAGCTTCTGCAAGTGCCTGC
>probe:Drosophila_2:1631347_at:466:623; Interrogation_Position=778; Antisense; TGCCCACGAGTATCCGCAGGTGAAA
>probe:Drosophila_2:1631347_at:57:699; Interrogation_Position=809; Antisense; TTTAACGCCACCTTTGTCAATCAGG
>probe:Drosophila_2:1631347_at:562:439; Interrogation_Position=875; Antisense; GAGGCCGAGAGCAATTTACTGGATC
>probe:Drosophila_2:1631347_at:48:675; Interrogation_Position=912; Antisense; TAGTTAGACTCCAACGTCCCAGTGA
>probe:Drosophila_2:1631347_at:536:99; Interrogation_Position=936; Antisense; AGATGTCTGGCATAAGCACCGGTCA
>probe:Drosophila_2:1631347_at:551:375; Interrogation_Position=991; Antisense; GAAGAGGATCTCTAGACACCAACGT

Paste this into a BLAST search page for me
CCAACGTCGCAGTGAGAGGTCTATAAGGAAGATTACCATACTCCTCTGCCGACAACCGACACGAGCTAACTGTAAGTCGGTGAACCCACAAATTCTCTGAGACTGCGCTGCCCACATGTTGGATCGGATCCCTTGGACTTGAACAGCATCGAACAGCATCGAGTACTATCAGAAGAACATGAGCTTCTGCAAGTGCCTGCTGCCCACGAGTATCCGCAGGTGAAATTTAACGCCACCTTTGTCAATCAGGGAGGCCGAGAGCAATTTACTGGATCTAGTTAGACTCCAACGTCCCAGTGAAGATGTCTGGCATAAGCACCGGTCAGAAGAGGATCTCTAGACACCAACGT

Full Affymetrix probeset data:

Annotations for 1631347_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime