Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631350_at:

>probe:Drosophila_2:1631350_at:428:557; Interrogation_Position=111; Antisense; GGACATTGACGACTTGGAGGACCTC
>probe:Drosophila_2:1631350_at:318:457; Interrogation_Position=199; Antisense; GATTCAAATGAACCCGAGTCCGACG
>probe:Drosophila_2:1631350_at:99:633; Interrogation_Position=217; Antisense; TCCGACGACGACTTAGATGAGCCTG
>probe:Drosophila_2:1631350_at:524:677; Interrogation_Position=230; Antisense; TAGATGAGCCTGAATCCCCGGAGGA
>probe:Drosophila_2:1631350_at:422:301; Interrogation_Position=246; Antisense; CCCGGAGGACGATTCCCAGAACAAT
>probe:Drosophila_2:1631350_at:506:205; Interrogation_Position=282; Antisense; AAGCGACGAGAGCATCCAGTACAAT
>probe:Drosophila_2:1631350_at:336:1; Interrogation_Position=321; Antisense; GCTCTAATGGGAATTAACCCTTTCT
>probe:Drosophila_2:1631350_at:211:659; Interrogation_Position=335; Antisense; TAACCCTTTCTATTCTTTATTGTCT
>probe:Drosophila_2:1631350_at:304:5; Interrogation_Position=353; Antisense; ATTGTCTTTATCTACACGCTTTCAC
>probe:Drosophila_2:1631350_at:516:665; Interrogation_Position=365; Antisense; TACACGCTTTCACCGGTCGTTAGAC
>probe:Drosophila_2:1631350_at:424:241; Interrogation_Position=37; Antisense; AATACAATGCGTGCCTATTTGCTGC
>probe:Drosophila_2:1631350_at:54:689; Interrogation_Position=52; Antisense; TATTTGCTGCTTGCCCTGTTTGGAT
>probe:Drosophila_2:1631350_at:649:547; Interrogation_Position=73; Antisense; GGATGTGTGCTTTTGGCCACAGTTT
>probe:Drosophila_2:1631350_at:21:153; Interrogation_Position=91; Antisense; ACAGTTTCCGCAAATCCGGTGGACA

Paste this into a BLAST search page for me
GGACATTGACGACTTGGAGGACCTCGATTCAAATGAACCCGAGTCCGACGTCCGACGACGACTTAGATGAGCCTGTAGATGAGCCTGAATCCCCGGAGGACCCGGAGGACGATTCCCAGAACAATAAGCGACGAGAGCATCCAGTACAATGCTCTAATGGGAATTAACCCTTTCTTAACCCTTTCTATTCTTTATTGTCTATTGTCTTTATCTACACGCTTTCACTACACGCTTTCACCGGTCGTTAGACAATACAATGCGTGCCTATTTGCTGCTATTTGCTGCTTGCCCTGTTTGGATGGATGTGTGCTTTTGGCCACAGTTTACAGTTTCCGCAAATCCGGTGGACA

Full Affymetrix probeset data:

Annotations for 1631350_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime