Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631354_x_at:

>probe:Drosophila_2:1631354_x_at:627:173; Interrogation_Position=16; Antisense; AAACCTAGCTCACAGCTCCCAGTAG
>probe:Drosophila_2:1631354_x_at:498:673; Interrogation_Position=21; Antisense; TAGCTCACAGCTCCCAGTAGTCACT
>probe:Drosophila_2:1631354_x_at:132:117; Interrogation_Position=29; Antisense; AGCTCCCAGTAGTCACTTCTACCAA
>probe:Drosophila_2:1631354_x_at:421:301; Interrogation_Position=33; Antisense; CCCAGTAGTCACTTCTACCAAACAA
>probe:Drosophila_2:1631354_x_at:422:679; Interrogation_Position=38; Antisense; TAGTCACTTCTACCAAACAAAGCAC
>probe:Drosophila_2:1631354_x_at:168:359; Interrogation_Position=428; Antisense; GAAGAAGTAATTCAACGGACTGTGA
>probe:Drosophila_2:1631354_x_at:623:649; Interrogation_Position=439; Antisense; TCAACGGACTGTGAATCCTACGCCT
>probe:Drosophila_2:1631354_x_at:51:407; Interrogation_Position=445; Antisense; GACTGTGAATCCTACGCCTCAATAA
>probe:Drosophila_2:1631354_x_at:419:713; Interrogation_Position=45; Antisense; TTCTACCAAACAAAGCACCAATCAA
>probe:Drosophila_2:1631354_x_at:628:367; Interrogation_Position=451; Antisense; GAATCCTACGCCTCAATAACAAATT
>probe:Drosophila_2:1631354_x_at:170:631; Interrogation_Position=454; Antisense; TCCTACGCCTCAATAACAAATTTTT
>probe:Drosophila_2:1631354_x_at:272:187; Interrogation_Position=53; Antisense; AACAAAGCACCAATCAACAATCAAC
>probe:Drosophila_2:1631354_x_at:563:33; Interrogation_Position=72; Antisense; ATCAACATGAAATTCATCGCCGTCT
>probe:Drosophila_2:1631354_x_at:633:253; Interrogation_Position=74; Antisense; CAACATGAAATTCATCGCCGTCTGC

Paste this into a BLAST search page for me
AAACCTAGCTCACAGCTCCCAGTAGTAGCTCACAGCTCCCAGTAGTCACTAGCTCCCAGTAGTCACTTCTACCAACCCAGTAGTCACTTCTACCAAACAATAGTCACTTCTACCAAACAAAGCACGAAGAAGTAATTCAACGGACTGTGATCAACGGACTGTGAATCCTACGCCTGACTGTGAATCCTACGCCTCAATAATTCTACCAAACAAAGCACCAATCAAGAATCCTACGCCTCAATAACAAATTTCCTACGCCTCAATAACAAATTTTTAACAAAGCACCAATCAACAATCAACATCAACATGAAATTCATCGCCGTCTCAACATGAAATTCATCGCCGTCTGC

Full Affymetrix probeset data:

Annotations for 1631354_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime