Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631355_at:

>probe:Drosophila_2:1631355_at:274:39; Interrogation_Position=112; Antisense; ATCTGGTGTACCGATGGCTTCATTA
>probe:Drosophila_2:1631355_at:187:713; Interrogation_Position=130; Antisense; TTCATTAACCTGTCGTTCCCGAATG
>probe:Drosophila_2:1631355_at:161:589; Interrogation_Position=159; Antisense; TGGTCATTCGACTTATCAGCGGTAA
>probe:Drosophila_2:1631355_at:119:439; Interrogation_Position=200; Antisense; GAGGAATCTACTCCCGCAGTGAATA
>probe:Drosophila_2:1631355_at:245:177; Interrogation_Position=228; Antisense; AAACGGCGGAGATTGGCAGCAGCAA
>probe:Drosophila_2:1631355_at:239:307; Interrogation_Position=337; Antisense; CCTGCTGCGCAACTCCAAATTAATT
>probe:Drosophila_2:1631355_at:524:533; Interrogation_Position=385; Antisense; GGTGGTCAGTGGCAAGATCTTTCAT
>probe:Drosophila_2:1631355_at:71:519; Interrogation_Position=413; Antisense; GTGGGCGATGATCTCTACATAGACT
>probe:Drosophila_2:1631355_at:309:467; Interrogation_Position=441; Antisense; GTTGGAAGTTTCACTGCGTCTGCAG
>probe:Drosophila_2:1631355_at:35:251; Interrogation_Position=478; Antisense; CAATGCCAGCGACTATGTGCGAGGA
>probe:Drosophila_2:1631355_at:566:437; Interrogation_Position=498; Antisense; GAGGAGCCCGTGTTCGACTGCGCAT
>probe:Drosophila_2:1631355_at:122:551; Interrogation_Position=532; Antisense; GGAGTTGTCCACCAAGTTTCTGGGT
>probe:Drosophila_2:1631355_at:419:477; Interrogation_Position=547; Antisense; GTTTCTGGGTTCGTCCAAGGATATT
>probe:Drosophila_2:1631355_at:438:95; Interrogation_Position=586; Antisense; AGATTGCCATTTGCTGGGTCTCCTG

Paste this into a BLAST search page for me
ATCTGGTGTACCGATGGCTTCATTATTCATTAACCTGTCGTTCCCGAATGTGGTCATTCGACTTATCAGCGGTAAGAGGAATCTACTCCCGCAGTGAATAAAACGGCGGAGATTGGCAGCAGCAACCTGCTGCGCAACTCCAAATTAATTGGTGGTCAGTGGCAAGATCTTTCATGTGGGCGATGATCTCTACATAGACTGTTGGAAGTTTCACTGCGTCTGCAGCAATGCCAGCGACTATGTGCGAGGAGAGGAGCCCGTGTTCGACTGCGCATGGAGTTGTCCACCAAGTTTCTGGGTGTTTCTGGGTTCGTCCAAGGATATTAGATTGCCATTTGCTGGGTCTCCTG

Full Affymetrix probeset data:

Annotations for 1631355_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime