FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631356_at:

>probe:Drosophila_2:1631356_at:346:203; Interrogation_Position=119; Antisense; AACCAACCTGCCCTGATGAATCAGA
>probe:Drosophila_2:1631356_at:594:363; Interrogation_Position=17; Antisense; GAATATGCATGCGAACAAACCTTTG
>probe:Drosophila_2:1631356_at:262:297; Interrogation_Position=177; Antisense; CGCAGACGGCGCAGCAGGAACAGAT
>probe:Drosophila_2:1631356_at:141:155; Interrogation_Position=211; Antisense; ACAGGGCATTGTGCTGAGGGACTTC
>probe:Drosophila_2:1631356_at:730:81; Interrogation_Position=227; Antisense; AGGGACTTCGATGGCGTTCTGCAGC
>probe:Drosophila_2:1631356_at:562:125; Interrogation_Position=249; Antisense; AGCCGATCATCGAGTCCTGCACGAA
>probe:Drosophila_2:1631356_at:655:371; Interrogation_Position=271; Antisense; GAAGGACAGCATCTCTGCAGGCAAG
>probe:Drosophila_2:1631356_at:80:543; Interrogation_Position=300; Antisense; GGATTTTACAGCATTCAACCGACAG
>probe:Drosophila_2:1631356_at:29:257; Interrogation_Position=32; Antisense; CAAACCTTTGTGTGCCTAATGACCA
>probe:Drosophila_2:1631356_at:69:371; Interrogation_Position=361; Antisense; GAAGTATGCCTCAGTTTTATACCTA
>probe:Drosophila_2:1631356_at:725:247; Interrogation_Position=410; Antisense; AATTGTGTTTCTTTCTTTCAACGAG
>probe:Drosophila_2:1631356_at:53:487; Interrogation_Position=43; Antisense; GTGCCTAATGACCAAACCGAACCGA
>probe:Drosophila_2:1631356_at:164:123; Interrogation_Position=505; Antisense; AGCGATTGTGCGATTGAGACTTCCA
>probe:Drosophila_2:1631356_at:700:423; Interrogation_Position=520; Antisense; GAGACTTCCACAGAGAGGCTCGAGA

Paste this into a BLAST search page for me
AACCAACCTGCCCTGATGAATCAGAGAATATGCATGCGAACAAACCTTTGCGCAGACGGCGCAGCAGGAACAGATACAGGGCATTGTGCTGAGGGACTTCAGGGACTTCGATGGCGTTCTGCAGCAGCCGATCATCGAGTCCTGCACGAAGAAGGACAGCATCTCTGCAGGCAAGGGATTTTACAGCATTCAACCGACAGCAAACCTTTGTGTGCCTAATGACCAGAAGTATGCCTCAGTTTTATACCTAAATTGTGTTTCTTTCTTTCAACGAGGTGCCTAATGACCAAACCGAACCGAAGCGATTGTGCGATTGAGACTTCCAGAGACTTCCACAGAGAGGCTCGAGA

Full Affymetrix probeset data:

Annotations for 1631356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720