FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631358_at:

>probe:Drosophila_2:1631358_at:582:223; Interrogation_Position=1015; Antisense; AAGGAGGATTTTCACACTCACCCGT
>probe:Drosophila_2:1631358_at:281:621; Interrogation_Position=1053; Antisense; TGCTCGCTCAAATCGGCCAAAGATG
>probe:Drosophila_2:1631358_at:282:393; Interrogation_Position=1080; Antisense; GAAAGGGCGTCATTCATCCTGGCCG
>probe:Drosophila_2:1631358_at:35:695; Interrogation_Position=1137; Antisense; TTTCCGTCGGCCTTAACAATCAGAT
>probe:Drosophila_2:1631358_at:466:265; Interrogation_Position=1157; Antisense; CAGATTCGCTGTTGCATTTGTGCCA
>probe:Drosophila_2:1631358_at:381:17; Interrogation_Position=1172; Antisense; ATTTGTGCCATTGCCCGTTTTCGCA
>probe:Drosophila_2:1631358_at:244:351; Interrogation_Position=1194; Antisense; GCAGTTTCCGCATTGTGATTTACCA
>probe:Drosophila_2:1631358_at:419:521; Interrogation_Position=1231; Antisense; GTGGCGTGTAGCTAGTGGCACTCCT
>probe:Drosophila_2:1631358_at:339:465; Interrogation_Position=1407; Antisense; GGTTTAGTTCGAGAGCTCTTGTCAA
>probe:Drosophila_2:1631358_at:568:31; Interrogation_Position=1435; Antisense; ATAATTGCAATTTCGCTTGTGGCAT
>probe:Drosophila_2:1631358_at:83:573; Interrogation_Position=863; Antisense; GGCGGGTTGGGCACTCAATTTAAAG
>probe:Drosophila_2:1631358_at:161:371; Interrogation_Position=936; Antisense; GAATGGCAACCGAGCCGGAGGCTCA
>probe:Drosophila_2:1631358_at:537:435; Interrogation_Position=953; Antisense; GAGGCTCATTTCATAGACCAACACC
>probe:Drosophila_2:1631358_at:124:239; Interrogation_Position=993; Antisense; AATACATTCTACACCCGGGATTAAG

Paste this into a BLAST search page for me
AAGGAGGATTTTCACACTCACCCGTTGCTCGCTCAAATCGGCCAAAGATGGAAAGGGCGTCATTCATCCTGGCCGTTTCCGTCGGCCTTAACAATCAGATCAGATTCGCTGTTGCATTTGTGCCAATTTGTGCCATTGCCCGTTTTCGCAGCAGTTTCCGCATTGTGATTTACCAGTGGCGTGTAGCTAGTGGCACTCCTGGTTTAGTTCGAGAGCTCTTGTCAAATAATTGCAATTTCGCTTGTGGCATGGCGGGTTGGGCACTCAATTTAAAGGAATGGCAACCGAGCCGGAGGCTCAGAGGCTCATTTCATAGACCAACACCAATACATTCTACACCCGGGATTAAG

Full Affymetrix probeset data:

Annotations for 1631358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720