Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631360_at:

>probe:Drosophila_2:1631360_at:393:71; Interrogation_Position=2061; Antisense; AGGCGCTGGAGCTCCTGGCGATACA
>probe:Drosophila_2:1631360_at:318:583; Interrogation_Position=2076; Antisense; TGGCGATACACAGCGTCACTACAAC
>probe:Drosophila_2:1631360_at:116:137; Interrogation_Position=2122; Antisense; ACGAGGCATCGCCATGTGGGTTCCT
>probe:Drosophila_2:1631360_at:582:499; Interrogation_Position=2204; Antisense; GTCTGGGTCAGAACGAGCACTACAT
>probe:Drosophila_2:1631360_at:509:421; Interrogation_Position=2218; Antisense; GAGCACTACATCTACGTGACCTATC
>probe:Drosophila_2:1631360_at:598:683; Interrogation_Position=2239; Antisense; TATCCACCGGACCTCAAGAAGCGCT
>probe:Drosophila_2:1631360_at:156:379; Interrogation_Position=2256; Antisense; GAAGCGCTACTTCGAGTGATGCACT
>probe:Drosophila_2:1631360_at:330:407; Interrogation_Position=2288; Antisense; GACTGGGTGCGCTCACAGATGATCG
>probe:Drosophila_2:1631360_at:37:425; Interrogation_Position=2320; Antisense; GAGACTATGGTCGAGCTTTCAAAGA
>probe:Drosophila_2:1631360_at:482:65; Interrogation_Position=2370; Antisense; ATGGAGTGACCAAAGGGCCTTCAAA
>probe:Drosophila_2:1631360_at:331:447; Interrogation_Position=2411; Antisense; GATACCAAAGCCAGAGTTCAACTAC
>probe:Drosophila_2:1631360_at:577:231; Interrogation_Position=2475; Antisense; AATGAGCGGAGGTCTGGTCGCCAAC
>probe:Drosophila_2:1631360_at:129:537; Interrogation_Position=2490; Antisense; GGTCGCCAACATAGCCCCAAAAGTT
>probe:Drosophila_2:1631360_at:677:587; Interrogation_Position=2514; Antisense; TGGATTTTTACTTTTAGCCTGCAAA

Paste this into a BLAST search page for me
AGGCGCTGGAGCTCCTGGCGATACATGGCGATACACAGCGTCACTACAACACGAGGCATCGCCATGTGGGTTCCTGTCTGGGTCAGAACGAGCACTACATGAGCACTACATCTACGTGACCTATCTATCCACCGGACCTCAAGAAGCGCTGAAGCGCTACTTCGAGTGATGCACTGACTGGGTGCGCTCACAGATGATCGGAGACTATGGTCGAGCTTTCAAAGAATGGAGTGACCAAAGGGCCTTCAAAGATACCAAAGCCAGAGTTCAACTACAATGAGCGGAGGTCTGGTCGCCAACGGTCGCCAACATAGCCCCAAAAGTTTGGATTTTTACTTTTAGCCTGCAAA

Full Affymetrix probeset data:

Annotations for 1631360_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime