Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631362_at:

>probe:Drosophila_2:1631362_at:98:619; Interrogation_Position=141; Antisense; TGCTTTCACCCGTCGATCAAATGCG
>probe:Drosophila_2:1631362_at:541:291; Interrogation_Position=151; Antisense; CGTCGATCAAATGCGCCAATTCAGG
>probe:Drosophila_2:1631362_at:370:645; Interrogation_Position=171; Antisense; TCAGGCGAAAAAGGCCAAGTTCAAT
>probe:Drosophila_2:1631362_at:181:453; Interrogation_Position=207; Antisense; GATCAAGTCCGTTATTTCGAAGTCG
>probe:Drosophila_2:1631362_at:214:689; Interrogation_Position=221; Antisense; TTTCGAAGTCGGTCAACAAGAGCGT
>probe:Drosophila_2:1631362_at:16:123; Interrogation_Position=241; Antisense; AGCGTGGAGAGCGAACTGCGCTCCC
>probe:Drosophila_2:1631362_at:171:321; Interrogation_Position=268; Antisense; GCCCACGAGGGCTACATCCAGTTGA
>probe:Drosophila_2:1631362_at:419:665; Interrogation_Position=280; Antisense; TACATCCAGTTGAGCAAGGCCCAGG
>probe:Drosophila_2:1631362_at:599:577; Interrogation_Position=351; Antisense; GGCCAGTACCGCCAAGTCCGCGGAA
>probe:Drosophila_2:1631362_at:110:501; Interrogation_Position=366; Antisense; GTCCGCGGAATAGCTTACTCTAGGC
>probe:Drosophila_2:1631362_at:252:281; Interrogation_Position=383; Antisense; CTCTAGGCATAAGTACTCTGTTGAT
>probe:Drosophila_2:1631362_at:142:467; Interrogation_Position=402; Antisense; GTTGATAACCAAATGACCTGCATAT
>probe:Drosophila_2:1631362_at:280:497; Interrogation_Position=57; Antisense; GTCATTTGTAAAGATGCCACAGGGA
>probe:Drosophila_2:1631362_at:195:111; Interrogation_Position=89; Antisense; AGAAGGCCAAGCTACCAGCAGCGAT

Paste this into a BLAST search page for me
TGCTTTCACCCGTCGATCAAATGCGCGTCGATCAAATGCGCCAATTCAGGTCAGGCGAAAAAGGCCAAGTTCAATGATCAAGTCCGTTATTTCGAAGTCGTTTCGAAGTCGGTCAACAAGAGCGTAGCGTGGAGAGCGAACTGCGCTCCCGCCCACGAGGGCTACATCCAGTTGATACATCCAGTTGAGCAAGGCCCAGGGGCCAGTACCGCCAAGTCCGCGGAAGTCCGCGGAATAGCTTACTCTAGGCCTCTAGGCATAAGTACTCTGTTGATGTTGATAACCAAATGACCTGCATATGTCATTTGTAAAGATGCCACAGGGAAGAAGGCCAAGCTACCAGCAGCGAT

Full Affymetrix probeset data:

Annotations for 1631362_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime