FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631363_at:

>probe:Drosophila_2:1631363_at:491:375; Interrogation_Position=1013; Antisense; GAAGCAGGAACTCGCTCTTTGTGCA
>probe:Drosophila_2:1631363_at:164:339; Interrogation_Position=1026; Antisense; GCTCTTTGTGCACATCGGTACGAGG
>probe:Drosophila_2:1631363_at:466:207; Interrogation_Position=1104; Antisense; AAGCTGCAGGTCGATGTTGAGGATC
>probe:Drosophila_2:1631363_at:682:239; Interrogation_Position=1155; Antisense; AATCACTTGATCGAGCTAGACCAGC
>probe:Drosophila_2:1631363_at:422:417; Interrogation_Position=1218; Antisense; GAGCAAATCCATGAGGTTCTCGGAC
>probe:Drosophila_2:1631363_at:594:541; Interrogation_Position=1232; Antisense; GGTTCTCGGACAAAACTGGCAGATG
>probe:Drosophila_2:1631363_at:604:213; Interrogation_Position=762; Antisense; AAGAGCGCATCGTCGCATGTCGAGA
>probe:Drosophila_2:1631363_at:176:81; Interrogation_Position=817; Antisense; AGGTGACGAATGAACATCGCCGGAT
>probe:Drosophila_2:1631363_at:453:189; Interrogation_Position=849; Antisense; AACAGTCAACATATAGCCACCGCTT
>probe:Drosophila_2:1631363_at:44:675; Interrogation_Position=862; Antisense; TAGCCACCGCTTTGGAGAAGGCCAC
>probe:Drosophila_2:1631363_at:385:109; Interrogation_Position=877; Antisense; AGAAGGCCACGGCTGTGCTTTCGCT
>probe:Drosophila_2:1631363_at:265:619; Interrogation_Position=892; Antisense; TGCTTTCGCTGTGCAAGGTGGATGA
>probe:Drosophila_2:1631363_at:388:469; Interrogation_Position=959; Antisense; GTTGCCCACCTGTAAAGTTAATTAT
>probe:Drosophila_2:1631363_at:234:119; Interrogation_Position=988; Antisense; AGCTCCTTCAGGATGCAGAGGCCAA

Paste this into a BLAST search page for me
GAAGCAGGAACTCGCTCTTTGTGCAGCTCTTTGTGCACATCGGTACGAGGAAGCTGCAGGTCGATGTTGAGGATCAATCACTTGATCGAGCTAGACCAGCGAGCAAATCCATGAGGTTCTCGGACGGTTCTCGGACAAAACTGGCAGATGAAGAGCGCATCGTCGCATGTCGAGAAGGTGACGAATGAACATCGCCGGATAACAGTCAACATATAGCCACCGCTTTAGCCACCGCTTTGGAGAAGGCCACAGAAGGCCACGGCTGTGCTTTCGCTTGCTTTCGCTGTGCAAGGTGGATGAGTTGCCCACCTGTAAAGTTAATTATAGCTCCTTCAGGATGCAGAGGCCAA

Full Affymetrix probeset data:

Annotations for 1631363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720