FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631364_at:

>probe:Drosophila_2:1631364_at:170:319; Interrogation_Position=158; Antisense; GCCGAACGCTGACCATGCACAAGAT
>probe:Drosophila_2:1631364_at:493:383; Interrogation_Position=210; Antisense; GAACTCGTCGAACTCATCGGGCGGA
>probe:Drosophila_2:1631364_at:465:683; Interrogation_Position=263; Antisense; TATCGGCATCGCTGAAGCGCCAGAA
>probe:Drosophila_2:1631364_at:641:371; Interrogation_Position=285; Antisense; GAAGTCGACGGGAACGCATCCAAGT
>probe:Drosophila_2:1631364_at:592:427; Interrogation_Position=403; Antisense; GAGATTACGCAGAAACCAGCCCGTC
>probe:Drosophila_2:1631364_at:56:535; Interrogation_Position=432; Antisense; GGTGCAAAACTCATCGCAGCTCAAG
>probe:Drosophila_2:1631364_at:546:233; Interrogation_Position=465; Antisense; AATGCTGCTAATTGTCTCGACGGTT
>probe:Drosophila_2:1631364_at:48:631; Interrogation_Position=481; Antisense; TCGACGGTTTTTGTTTGCCTCAATT
>probe:Drosophila_2:1631364_at:606:621; Interrogation_Position=518; Antisense; TGCTGCGCATCGAGGCCTATTGGGA
>probe:Drosophila_2:1631364_at:234:431; Interrogation_Position=547; Antisense; GAGTCGGCCCGAAACCAGAATTCCA
>probe:Drosophila_2:1631364_at:642:21; Interrogation_Position=587; Antisense; ATATTTTTCACGCTTTCTTCATCAC
>probe:Drosophila_2:1631364_at:270:651; Interrogation_Position=623; Antisense; TCAATTTCGTGCTTTACTGCGTCAG
>probe:Drosophila_2:1631364_at:47:365; Interrogation_Position=654; Antisense; GAATTTCCGCAAAGCCGTTTTGAGT
>probe:Drosophila_2:1631364_at:455:695; Interrogation_Position=681; Antisense; TTTCCGAAGGGTTTCATCCGCTCAA

Paste this into a BLAST search page for me
GCCGAACGCTGACCATGCACAAGATGAACTCGTCGAACTCATCGGGCGGATATCGGCATCGCTGAAGCGCCAGAAGAAGTCGACGGGAACGCATCCAAGTGAGATTACGCAGAAACCAGCCCGTCGGTGCAAAACTCATCGCAGCTCAAGAATGCTGCTAATTGTCTCGACGGTTTCGACGGTTTTTGTTTGCCTCAATTTGCTGCGCATCGAGGCCTATTGGGAGAGTCGGCCCGAAACCAGAATTCCAATATTTTTCACGCTTTCTTCATCACTCAATTTCGTGCTTTACTGCGTCAGGAATTTCCGCAAAGCCGTTTTGAGTTTTCCGAAGGGTTTCATCCGCTCAA

Full Affymetrix probeset data:

Annotations for 1631364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720