FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631365_at:

>probe:Drosophila_2:1631365_at:600:487; Interrogation_Position=322; Antisense; GTACGGTACTCCATGCTGTTGCTTT
>probe:Drosophila_2:1631365_at:120:459; Interrogation_Position=357; Antisense; GATATTTTCGCATTACTACGCCTGG
>probe:Drosophila_2:1631365_at:694:591; Interrogation_Position=379; Antisense; TGGTGGGCGTACATCAACTACTACA
>probe:Drosophila_2:1631365_at:723:475; Interrogation_Position=459; Antisense; GTTTTCAACGGTCCTAGTGATGCAC
>probe:Drosophila_2:1631365_at:481:171; Interrogation_Position=517; Antisense; AAAGTCTTCTGCATTGTCGGCATCG
>probe:Drosophila_2:1631365_at:192:579; Interrogation_Position=558; Antisense; GGCCAGCAGTTTTGATCAGTTCTTC
>probe:Drosophila_2:1631365_at:630:433; Interrogation_Position=601; Antisense; GAGGGTTACGCCCACCAGATAGTGC
>probe:Drosophila_2:1631365_at:304:423; Interrogation_Position=626; Antisense; GAGACATCGGGTTCATGGTGCCTGA
>probe:Drosophila_2:1631365_at:367:503; Interrogation_Position=667; Antisense; GTCCCAGTTTGGCTGCTACGACAGA
>probe:Drosophila_2:1631365_at:108:107; Interrogation_Position=689; Antisense; AGACACGTCGCGAATGTTATACCAC
>probe:Drosophila_2:1631365_at:148:459; Interrogation_Position=748; Antisense; GATATTGTGTTGATGCTGTGCCTGG
>probe:Drosophila_2:1631365_at:378:141; Interrogation_Position=796; Antisense; ACGGTTTTTGCCCATGCAGGATGCG
>probe:Drosophila_2:1631365_at:17:713; Interrogation_Position=825; Antisense; TTCAGCTGCTGAATCGCTACCGGAT
>probe:Drosophila_2:1631365_at:679:339; Interrogation_Position=840; Antisense; GCTACCGGATGCTGGCCAGTGGAAA

Paste this into a BLAST search page for me
GTACGGTACTCCATGCTGTTGCTTTGATATTTTCGCATTACTACGCCTGGTGGTGGGCGTACATCAACTACTACAGTTTTCAACGGTCCTAGTGATGCACAAAGTCTTCTGCATTGTCGGCATCGGGCCAGCAGTTTTGATCAGTTCTTCGAGGGTTACGCCCACCAGATAGTGCGAGACATCGGGTTCATGGTGCCTGAGTCCCAGTTTGGCTGCTACGACAGAAGACACGTCGCGAATGTTATACCACGATATTGTGTTGATGCTGTGCCTGGACGGTTTTTGCCCATGCAGGATGCGTTCAGCTGCTGAATCGCTACCGGATGCTACCGGATGCTGGCCAGTGGAAA

Full Affymetrix probeset data:

Annotations for 1631365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720