FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631366_at:

>probe:Drosophila_2:1631366_at:362:61; Interrogation_Position=13; Antisense; ATGTCCGTCCTGAAAGTATTCATCT
>probe:Drosophila_2:1631366_at:30:511; Interrogation_Position=136; Antisense; GTGCACCACCATCACGTTCAGAAGG
>probe:Drosophila_2:1631366_at:489:271; Interrogation_Position=145; Antisense; CATCACGTTCAGAAGGTCCATGTGC
>probe:Drosophila_2:1631366_at:458:629; Interrogation_Position=161; Antisense; TCCATGTGCCGGTGGTGAAGCACGT
>probe:Drosophila_2:1631366_at:676:591; Interrogation_Position=173; Antisense; TGGTGAAGCACGTGCCGGTGCCCAT
>probe:Drosophila_2:1631366_at:281:499; Interrogation_Position=184; Antisense; GTGCCGGTGCCCATTTACAAGGAGG
>probe:Drosophila_2:1631366_at:268:77; Interrogation_Position=203; Antisense; AGGAGGTGCCCGTGCACCACGTCCA
>probe:Drosophila_2:1631366_at:598:611; Interrogation_Position=23; Antisense; TGAAAGTATTCATCTTCGTCGCCCT
>probe:Drosophila_2:1631366_at:137:77; Interrogation_Position=233; Antisense; AGGAGATCCCCGTGCCGGTGCACCA
>probe:Drosophila_2:1631366_at:183:437; Interrogation_Position=268; Antisense; GAGGAGATCCCGGTGCACCATGTCT
>probe:Drosophila_2:1631366_at:425:535; Interrogation_Position=279; Antisense; GGTGCACCATGTCTTCGATGACCAC
>probe:Drosophila_2:1631366_at:650:307; Interrogation_Position=327; Antisense; CCACCACGGACACGGCTGGCTGTAA
>probe:Drosophila_2:1631366_at:535:85; Interrogation_Position=73; Antisense; AGTCCCGGCTTCTTTGGCAAACACG
>probe:Drosophila_2:1631366_at:395:727; Interrogation_Position=86; Antisense; TTGGCAAACACGAGCACCACACCAT

Paste this into a BLAST search page for me
ATGTCCGTCCTGAAAGTATTCATCTGTGCACCACCATCACGTTCAGAAGGCATCACGTTCAGAAGGTCCATGTGCTCCATGTGCCGGTGGTGAAGCACGTTGGTGAAGCACGTGCCGGTGCCCATGTGCCGGTGCCCATTTACAAGGAGGAGGAGGTGCCCGTGCACCACGTCCATGAAAGTATTCATCTTCGTCGCCCTAGGAGATCCCCGTGCCGGTGCACCAGAGGAGATCCCGGTGCACCATGTCTGGTGCACCATGTCTTCGATGACCACCCACCACGGACACGGCTGGCTGTAAAGTCCCGGCTTCTTTGGCAAACACGTTGGCAAACACGAGCACCACACCAT

Full Affymetrix probeset data:

Annotations for 1631366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720